Incidental Mutation 'R5753:Rnps1'
ID444921
Institutional Source Beutler Lab
Gene Symbol Rnps1
Ensembl Gene ENSMUSG00000034681
Gene Nameribonucleic acid binding protein S1
Synonyms
MMRRC Submission 043358-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5753 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location24414675-24425895 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 24418164 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000111028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088512] [ENSMUST00000115371] [ENSMUST00000163717]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000084725
Predicted Effect unknown
Transcript: ENSMUST00000088512
AA Change: V6A
SMART Domains Protein: ENSMUSP00000085867
Gene: ENSMUSG00000034681
AA Change: V6A

DomainStartEndE-ValueType
low complexity region 30 46 N/A INTRINSIC
low complexity region 55 157 N/A INTRINSIC
RRM 162 236 5.12e-21 SMART
low complexity region 243 305 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115371
SMART Domains Protein: ENSMUSP00000111028
Gene: ENSMUSG00000034681

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
low complexity region 32 134 N/A INTRINSIC
RRM 139 213 5.12e-21 SMART
low complexity region 220 282 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000163717
AA Change: V6A
SMART Domains Protein: ENSMUSP00000126345
Gene: ENSMUSG00000034681
AA Change: V6A

DomainStartEndE-ValueType
low complexity region 30 46 N/A INTRINSIC
low complexity region 55 157 N/A INTRINSIC
RRM 162 236 5.12e-21 SMART
low complexity region 243 305 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180390
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180579
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180721
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181014
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181259
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181760
Meta Mutation Damage Score 0.0606 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is part of a post-splicing multiprotein complex involved in both mRNA nuclear export and mRNA surveillance. mRNA surveillance detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD). When translation ends upstream from the last exon-exon junction, this triggers NMD to degrade mRNAs containing premature stop codons. This protein binds to the mRNA and remains bound after nuclear export, acting as a nucleocytoplasmic shuttling protein. This protein contains many serine residues. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik C T 5: 87,972,515 T377I probably damaging Het
Abcb1a A G 5: 8,723,160 D796G probably damaging Het
Actn3 T C 19: 4,864,567 probably null Het
Ada A T 2: 163,735,398 S57T probably benign Het
Adamts6 A G 13: 104,347,350 Y359C probably damaging Het
Adcy1 A T 11: 7,130,300 I348F probably damaging Het
Ankrd11 T C 8: 122,895,304 E603G possibly damaging Het
Bcas3 A G 11: 85,822,084 probably benign Het
Cldn1 C A 16: 26,363,121 V113L probably benign Het
Dock9 T C 14: 121,634,625 T540A probably benign Het
Erp27 A G 6: 136,919,877 F109S probably damaging Het
F13a1 G A 13: 36,898,108 Q541* probably null Het
Fam124a T C 14: 62,606,539 S499P probably benign Het
Fgd3 T A 13: 49,274,940 E486V possibly damaging Het
Flnc T C 6: 29,433,489 S11P probably benign Het
Gm12508 C A 4: 55,254,787 noncoding transcript Het
Grk2 C T 19: 4,290,468 R295H probably damaging Het
Gtf2ird1 A G 5: 134,410,983 M131T probably damaging Het
Hist1h4d G A 13: 23,581,604 M1I probably null Het
Itpripl2 A G 7: 118,491,009 V109A probably damaging Het
Jakmip2 T C 18: 43,559,116 E585G probably damaging Het
Kbtbd3 A T 9: 4,331,404 I593F possibly damaging Het
Lgr4 C T 2: 110,002,512 Q316* probably null Het
Mcf2l T C 8: 12,999,993 F305S probably damaging Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Olfr1143 A T 2: 87,803,252 M288L probably benign Het
Olfr1264 T C 2: 90,021,503 T188A possibly damaging Het
Olfr1301 T A 2: 111,754,801 I184K possibly damaging Het
Olfr19 A T 16: 16,673,620 Y120* probably null Het
Olfr64 A G 7: 103,893,201 L178P probably damaging Het
Olfr73 G A 2: 88,034,576 L188F probably damaging Het
Olfr735 T A 14: 50,345,588 T285S probably damaging Het
Pcdh9 T A 14: 93,888,161 D191V probably damaging Het
Pde4d T A 13: 109,772,722 probably benign Het
Phkb C T 8: 85,878,230 A88V probably damaging Het
Plec A G 15: 76,173,420 S4128P probably damaging Het
Plekha5 A T 6: 140,537,004 probably null Het
Rgs13 A C 1: 144,140,740 N88K probably benign Het
Rho T A 6: 115,935,487 I104N probably damaging Het
Slc10a7 G T 8: 78,525,299 probably null Het
Slc39a7 C T 17: 34,030,176 R246K probably damaging Het
Sort1 G C 3: 108,345,774 G510A probably damaging Het
Spag6l A G 16: 16,766,967 probably null Het
Sync T A 4: 129,293,386 Y70* probably null Het
Tex45 A T 8: 3,484,112 I350L probably benign Het
Timm8a2 T C 14: 122,034,877 V64A probably benign Het
Tnfrsf11b C A 15: 54,254,059 V267L possibly damaging Het
Trim30b A G 7: 104,357,337 V104A possibly damaging Het
Tusc3 T C 8: 39,096,946 S244P probably damaging Het
Usp16 T A 16: 87,482,899 Y746N probably damaging Het
Vax1 G T 19: 59,166,382 H274Q probably benign Het
Vmn2r108 A G 17: 20,462,917 V675A probably damaging Het
Vmn2r12 A T 5: 109,091,804 W298R probably damaging Het
Zfp948 A G 17: 21,586,894 N116S probably damaging Het
Zkscan2 A G 7: 123,480,700 V678A probably benign Het
Other mutations in Rnps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01339:Rnps1 APN 17 24422299 missense probably damaging 1.00
IGL01433:Rnps1 APN 17 24424545 critical splice donor site probably null
IGL01984:Rnps1 APN 17 24424397 splice site probably benign
IGL03410:Rnps1 APN 17 24421861 splice site probably benign
unbalanced UTSW 17 24422168 missense probably damaging 1.00
R0594:Rnps1 UTSW 17 24424437 missense probably damaging 0.99
R1397:Rnps1 UTSW 17 24412057 unclassified probably benign
R1938:Rnps1 UTSW 17 24420390 missense unknown
R2321:Rnps1 UTSW 17 24422168 missense probably damaging 1.00
R3085:Rnps1 UTSW 17 24412419 unclassified probably benign
R3086:Rnps1 UTSW 17 24412419 unclassified probably benign
R4296:Rnps1 UTSW 17 24425115 unclassified probably benign
R5159:Rnps1 UTSW 17 24418512 missense unknown
R5193:Rnps1 UTSW 17 24418543 missense probably benign 0.23
R7378:Rnps1 UTSW 17 24418530 missense unknown
R7403:Rnps1 UTSW 17 24425087 missense unknown
R7690:Rnps1 UTSW 17 24418194 missense unknown
R8104:Rnps1 UTSW 17 24424510 missense unknown
Predicted Primers PCR Primer
(F):5'- ACACTTGCTGTTTGCTGTGC -3'
(R):5'- TGAATTAGGGCACGCACTGTAG -3'

Sequencing Primer
(F):5'- GCTCAACGGTCTTTGATGCAAAATAG -3'
(R):5'- TAGGGCACGCACTGTAGAACAAC -3'
Posted On2016-11-21