Incidental Mutation 'R5754:Atad2b'
ID 444961
Institutional Source Beutler Lab
Gene Symbol Atad2b
Ensembl Gene ENSMUSG00000052812
Gene Name ATPase family, AAA domain containing 2B
Synonyms D530031C13Rik, 1110014E10Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5754 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 4917353-5047394 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 5010351 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 915 (H915Q)
Ref Sequence ENSEMBL: ENSMUSP00000047445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045664] [ENSMUST00000218859]
AlphaFold E9Q166
Predicted Effect probably benign
Transcript: ENSMUST00000045664
AA Change: H915Q

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000047445
Gene: ENSMUSG00000052812
AA Change: H915Q

DomainStartEndE-ValueType
low complexity region 13 54 N/A INTRINSIC
low complexity region 135 146 N/A INTRINSIC
low complexity region 231 242 N/A INTRINSIC
low complexity region 252 278 N/A INTRINSIC
AAA 432 573 4.56e-20 SMART
SCOP:d1e32a2 771 912 3e-4 SMART
BROMO 958 1070 4.24e-20 SMART
low complexity region 1135 1144 N/A INTRINSIC
low complexity region 1230 1253 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218859
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the AAA ATPase family. This family member includes an N-terminal bromodomain. It has been found to be localized to the nucleus, partly to replication sites, consistent with a chromatin-related function. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit reduced body size and fertility in female mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,269,541 S609P probably damaging Het
Abcb4 T A 5: 8,934,320 N683K probably benign Het
Camk1d G T 2: 5,445,097 P91Q probably benign Het
Camk1d G C 2: 5,445,099 S90R probably damaging Het
Card11 T C 5: 140,899,769 E345G probably damaging Het
Ccdc58 A G 16: 36,085,057 N63S probably benign Het
Ccpg1 G T 9: 73,013,244 V714L possibly damaging Het
Chst9 T C 18: 15,453,197 E103G possibly damaging Het
Cnga1 C T 5: 72,605,272 V300I probably benign Het
Crb1 T C 1: 139,231,599 Y1295C probably damaging Het
Dnah5 A G 15: 28,401,868 T3392A probably benign Het
Elp3 C A 14: 65,547,990 R473L probably damaging Het
Epgn T A 5: 91,033,948 I145N probably benign Het
Fam107b G A 2: 3,778,420 G220D probably damaging Het
Fbn2 A G 18: 58,124,311 V328A probably benign Het
Fn1 A T 1: 71,600,322 I1770N probably damaging Het
Fndc1 T A 17: 7,769,753 Y1159F unknown Het
Frem2 A G 3: 53,537,258 L2484P probably damaging Het
Grk2 C T 19: 4,290,468 R295H probably damaging Het
Gtf3c1 A T 7: 125,644,065 V1789D possibly damaging Het
Hmgcl T C 4: 135,950,587 V33A probably damaging Het
Ighv7-1 A G 12: 113,896,619 F51S probably damaging Het
Kcna6 A G 6: 126,739,725 L67P probably damaging Het
Lamc1 A T 1: 153,247,284 V720E probably benign Het
Lrch1 T C 14: 74,817,118 D312G probably damaging Het
Nav2 A G 7: 49,557,046 T1540A probably damaging Het
Nisch A T 14: 31,191,416 probably benign Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Npc1l1 A G 11: 6,227,839 Y524H probably damaging Het
Nrap T C 19: 56,389,484 T25A possibly damaging Het
Nusap1 A G 2: 119,647,099 K363R probably damaging Het
Olfr1019 T C 2: 85,841,312 T160A probably damaging Het
Olfr1489 A G 19: 13,633,993 E294G probably damaging Het
Olfr873 T A 9: 20,301,094 L298Q probably damaging Het
Pde4d T C 13: 109,938,013 I384T probably damaging Het
Pkhd1 T A 1: 20,523,651 R1413* probably null Het
Plcd3 T A 11: 103,073,766 Y593F possibly damaging Het
Plxna1 A T 6: 89,333,105 I1026N possibly damaging Het
Podxl T A 6: 31,524,394 I409F probably damaging Het
Polq A C 16: 37,017,263 Q179P probably benign Het
Pomt1 T C 2: 32,247,590 V401A probably damaging Het
Qdpr C T 5: 45,439,385 G146S probably damaging Het
Shc4 T A 2: 125,670,298 Q2L probably damaging Het
Skint8 T A 4: 111,950,190 C358S probably benign Het
Smc5 T C 19: 23,244,103 E354G possibly damaging Het
Snx30 T C 4: 59,868,275 V129A probably damaging Het
Sp110 G C 1: 85,577,202 probably benign Het
Spag6 T A 2: 18,698,802 probably benign Het
Trim28 T A 7: 13,029,109 Y450N probably benign Het
Trip11 C T 12: 101,885,665 W428* probably null Het
Umodl1 T A 17: 30,994,787 V966E probably damaging Het
Utf1 A G 7: 139,944,791 probably benign Het
Vmn1r72 T C 7: 11,669,849 Y224C probably damaging Het
Whrn A G 4: 63,416,588 S748P probably damaging Het
Zbtb41 T A 1: 139,432,078 probably null Het
Zfhx3 T C 8: 108,800,332 F954L probably damaging Het
Zfp456 A T 13: 67,366,240 I449K probably benign Het
Other mutations in Atad2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Atad2b APN 12 5024593 missense probably damaging 1.00
IGL00917:Atad2b APN 12 4965837 unclassified probably benign
IGL01011:Atad2b APN 12 4965984 missense probably benign 0.01
IGL01092:Atad2b APN 12 5017987 missense probably damaging 0.98
IGL01604:Atad2b APN 12 4965837 unclassified probably benign
IGL01924:Atad2b APN 12 5034093 missense probably damaging 1.00
IGL02197:Atad2b APN 12 5018056 missense possibly damaging 0.84
IGL02397:Atad2b APN 12 4974046 missense probably damaging 1.00
IGL02404:Atad2b APN 12 4941972 missense probably benign 0.08
IGL02517:Atad2b APN 12 5018037 missense probably benign 0.07
IGL02726:Atad2b APN 12 4974003 nonsense probably null
IGL02896:Atad2b APN 12 4958151 missense probably damaging 1.00
IGL03227:Atad2b APN 12 5006715 missense probably damaging 1.00
IGL03265:Atad2b APN 12 5024628 missense probably benign 0.24
Plyers UTSW 12 4973970 missense probably damaging 1.00
Smidge UTSW 12 4990949 missense probably damaging 1.00
Tensor UTSW 12 4957558 missense probably damaging 1.00
Traction UTSW 12 5027182 critical splice donor site probably null
Vice UTSW 12 5018002 missense probably damaging 1.00
K3955:Atad2b UTSW 12 4954536 splice site probably benign
P0038:Atad2b UTSW 12 4954536 splice site probably benign
PIT4418001:Atad2b UTSW 12 5024587 missense probably benign 0.07
PIT4431001:Atad2b UTSW 12 5031795 missense possibly damaging 0.77
R0006:Atad2b UTSW 12 4942030 missense possibly damaging 0.81
R0006:Atad2b UTSW 12 4942030 missense possibly damaging 0.81
R0124:Atad2b UTSW 12 4952676 missense probably benign 0.23
R0462:Atad2b UTSW 12 4941973 missense possibly damaging 0.79
R0483:Atad2b UTSW 12 4945035 splice site probably benign
R0617:Atad2b UTSW 12 4937401 missense probably benign 0.43
R0894:Atad2b UTSW 12 4965915 missense probably damaging 1.00
R0942:Atad2b UTSW 12 5024591 missense probably damaging 1.00
R0960:Atad2b UTSW 12 5006593 splice site probably benign
R0973:Atad2b UTSW 12 5031784 missense probably benign 0.00
R1306:Atad2b UTSW 12 4974239 missense probably benign 0.08
R1530:Atad2b UTSW 12 4942018 nonsense probably null
R1678:Atad2b UTSW 12 4965899 missense possibly damaging 0.91
R1689:Atad2b UTSW 12 5034575 nonsense probably null
R1826:Atad2b UTSW 12 4974094 missense probably benign 0.00
R1996:Atad2b UTSW 12 4990883 missense probably benign 0.01
R2233:Atad2b UTSW 12 5006745 missense probably damaging 1.00
R2235:Atad2b UTSW 12 5006745 missense probably damaging 1.00
R2943:Atad2b UTSW 12 4942067 missense probably damaging 0.98
R3161:Atad2b UTSW 12 4939689 missense possibly damaging 0.87
R3162:Atad2b UTSW 12 4939689 missense possibly damaging 0.87
R3162:Atad2b UTSW 12 4939689 missense possibly damaging 0.87
R3508:Atad2b UTSW 12 4950595 critical splice donor site probably null
R4239:Atad2b UTSW 12 4985710 missense probably benign 0.05
R4401:Atad2b UTSW 12 4940145 missense probably damaging 0.99
R4558:Atad2b UTSW 12 4943223 missense probably benign 0.10
R4559:Atad2b UTSW 12 4943223 missense probably benign 0.10
R4573:Atad2b UTSW 12 4954663 splice site probably null
R4639:Atad2b UTSW 12 5018053 missense probably damaging 1.00
R4847:Atad2b UTSW 12 4944901 splice site probably null
R4850:Atad2b UTSW 12 4943251 missense probably benign 0.15
R4851:Atad2b UTSW 12 4943251 missense probably benign 0.15
R4979:Atad2b UTSW 12 5034513 missense probably damaging 1.00
R5024:Atad2b UTSW 12 4937534 missense probably benign 0.45
R5305:Atad2b UTSW 12 4965855 missense probably damaging 1.00
R5405:Atad2b UTSW 12 4940098 missense possibly damaging 0.87
R5627:Atad2b UTSW 12 4917911 missense probably benign 0.01
R6163:Atad2b UTSW 12 4954593 missense probably benign 0.00
R6371:Atad2b UTSW 12 4973970 missense probably damaging 1.00
R6374:Atad2b UTSW 12 5018002 missense probably damaging 1.00
R6399:Atad2b UTSW 12 4957558 missense probably damaging 1.00
R6433:Atad2b UTSW 12 4952642 missense possibly damaging 0.89
R6546:Atad2b UTSW 12 4990949 missense probably damaging 1.00
R6617:Atad2b UTSW 12 5024668 missense probably benign 0.00
R7199:Atad2b UTSW 12 5017992 missense probably damaging 1.00
R7267:Atad2b UTSW 12 5027105 nonsense probably null
R7405:Atad2b UTSW 12 4943232 missense probably benign 0.08
R7460:Atad2b UTSW 12 4952660 missense probably benign 0.28
R7568:Atad2b UTSW 12 5010390 critical splice donor site probably null
R7593:Atad2b UTSW 12 5031726 missense probably benign 0.16
R7648:Atad2b UTSW 12 5027182 critical splice donor site probably null
R8253:Atad2b UTSW 12 4974159 missense possibly damaging 0.54
R8253:Atad2b UTSW 12 4974160 missense probably benign 0.02
R8708:Atad2b UTSW 12 4961253 missense probably damaging 1.00
R8894:Atad2b UTSW 12 5014001 critical splice donor site probably null
R8948:Atad2b UTSW 12 4991012 missense possibly damaging 0.87
R8976:Atad2b UTSW 12 4917923 critical splice donor site probably null
R9052:Atad2b UTSW 12 4965982 missense probably damaging 1.00
R9057:Atad2b UTSW 12 5018102 nonsense probably null
R9134:Atad2b UTSW 12 5010351 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTGTGCTTATTGAGAATGGGAC -3'
(R):5'- CCTTGGATTAGGTACACACAGCC -3'

Sequencing Primer
(F):5'- AAGTACACTGTAGCTGTCGC -3'
(R):5'- GGATTAGGTACACACAGCCATTTTC -3'
Posted On 2016-11-21