Incidental Mutation 'R5754:Zfp456'
ID444964
Institutional Source Beutler Lab
Gene Symbol Zfp456
Ensembl Gene ENSMUSG00000078995
Gene Namezinc finger protein 456
SynonymsRslcan-13
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R5754 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location67362113-67375810 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 67366240 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 449 (I449K)
Ref Sequence ENSEMBL: ENSMUSP00000059686 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057070] [ENSMUST00000166080] [ENSMUST00000172266]
Predicted Effect probably benign
Transcript: ENSMUST00000057070
AA Change: I449K

PolyPhen 2 Score 0.399 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000059686
Gene: ENSMUSG00000078995
AA Change: I449K

DomainStartEndE-ValueType
KRAB 2 62 3.07e-33 SMART
ZnF_C2H2 106 128 1.92e-2 SMART
ZnF_C2H2 134 156 5.77e0 SMART
ZnF_C2H2 162 184 1.28e-3 SMART
ZnF_C2H2 190 212 2.36e-2 SMART
ZnF_C2H2 246 268 2.17e-1 SMART
ZnF_C2H2 274 296 7.37e-4 SMART
ZnF_C2H2 302 324 6.32e-3 SMART
ZnF_C2H2 330 352 2.4e-3 SMART
ZnF_C2H2 358 380 8.94e-3 SMART
ZnF_C2H2 386 408 1.92e-2 SMART
ZnF_C2H2 414 436 7.9e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165145
Predicted Effect probably benign
Transcript: ENSMUST00000166080
SMART Domains Protein: ENSMUSP00000126669
Gene: ENSMUSG00000098692

DomainStartEndE-ValueType
KRAB 2 62 3.07e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172266
SMART Domains Protein: ENSMUSP00000130928
Gene: ENSMUSG00000078995

DomainStartEndE-ValueType
KRAB 2 62 3.07e-33 SMART
Meta Mutation Damage Score 0.0964 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 98% (61/62)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,269,541 S609P probably damaging Het
Abcb4 T A 5: 8,934,320 N683K probably benign Het
Atad2b T A 12: 5,010,351 H915Q probably benign Het
Camk1d G T 2: 5,445,097 P91Q probably benign Het
Camk1d G C 2: 5,445,099 S90R probably damaging Het
Card11 T C 5: 140,899,769 E345G probably damaging Het
Ccdc58 A G 16: 36,085,057 N63S probably benign Het
Ccpg1 G T 9: 73,013,244 V714L possibly damaging Het
Chst9 T C 18: 15,453,197 E103G possibly damaging Het
Cnga1 C T 5: 72,605,272 V300I probably benign Het
Crb1 T C 1: 139,231,599 Y1295C probably damaging Het
Dnah5 A G 15: 28,401,868 T3392A probably benign Het
Elp3 C A 14: 65,547,990 R473L probably damaging Het
Epgn T A 5: 91,033,948 I145N probably benign Het
Fam107b G A 2: 3,778,420 G220D probably damaging Het
Fbn2 A G 18: 58,124,311 V328A probably benign Het
Fn1 A T 1: 71,600,322 I1770N probably damaging Het
Fndc1 T A 17: 7,769,753 Y1159F unknown Het
Frem2 A G 3: 53,537,258 L2484P probably damaging Het
Grk2 C T 19: 4,290,468 R295H probably damaging Het
Gtf3c1 A T 7: 125,644,065 V1789D possibly damaging Het
Hmgcl T C 4: 135,950,587 V33A probably damaging Het
Ighv7-1 A G 12: 113,896,619 F51S probably damaging Het
Kcna6 A G 6: 126,739,725 L67P probably damaging Het
Lamc1 A T 1: 153,247,284 V720E probably benign Het
Lrch1 T C 14: 74,817,118 D312G probably damaging Het
Nav2 A G 7: 49,557,046 T1540A probably damaging Het
Nisch A T 14: 31,191,416 probably benign Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Npc1l1 A G 11: 6,227,839 Y524H probably damaging Het
Nrap T C 19: 56,389,484 T25A possibly damaging Het
Nusap1 A G 2: 119,647,099 K363R probably damaging Het
Olfr1019 T C 2: 85,841,312 T160A probably damaging Het
Olfr1489 A G 19: 13,633,993 E294G probably damaging Het
Olfr873 T A 9: 20,301,094 L298Q probably damaging Het
Pde4d T C 13: 109,938,013 I384T probably damaging Het
Pkhd1 T A 1: 20,523,651 R1413* probably null Het
Plcd3 T A 11: 103,073,766 Y593F possibly damaging Het
Plxna1 A T 6: 89,333,105 I1026N possibly damaging Het
Podxl T A 6: 31,524,394 I409F probably damaging Het
Polq A C 16: 37,017,263 Q179P probably benign Het
Pomt1 T C 2: 32,247,590 V401A probably damaging Het
Qdpr C T 5: 45,439,385 G146S probably damaging Het
Shc4 T A 2: 125,670,298 Q2L probably damaging Het
Skint8 T A 4: 111,950,190 C358S probably benign Het
Smc5 T C 19: 23,244,103 E354G possibly damaging Het
Snx30 T C 4: 59,868,275 V129A probably damaging Het
Sp110 G C 1: 85,577,202 probably benign Het
Spag6 T A 2: 18,698,802 probably benign Het
Trim28 T A 7: 13,029,109 Y450N probably benign Het
Trip11 C T 12: 101,885,665 W428* probably null Het
Umodl1 T A 17: 30,994,787 V966E probably damaging Het
Utf1 A G 7: 139,944,791 probably benign Het
Vmn1r72 T C 7: 11,669,849 Y224C probably damaging Het
Whrn A G 4: 63,416,588 S748P probably damaging Het
Zbtb41 T A 1: 139,432,078 probably null Het
Zfhx3 T C 8: 108,800,332 F954L probably damaging Het
Other mutations in Zfp456
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01769:Zfp456 APN 13 67367153 missense probably benign 0.06
IGL03200:Zfp456 APN 13 67366477 missense probably benign
IGL03406:Zfp456 APN 13 67366331 missense probably damaging 0.98
R0667:Zfp456 UTSW 13 67366742 missense probably benign 0.00
R0729:Zfp456 UTSW 13 67366544 missense probably damaging 1.00
R1731:Zfp456 UTSW 13 67366555 missense probably benign 0.39
R1832:Zfp456 UTSW 13 67367363 missense probably benign 0.09
R2011:Zfp456 UTSW 13 67366874 nonsense probably null
R2022:Zfp456 UTSW 13 67366497 nonsense probably null
R2023:Zfp456 UTSW 13 67366497 nonsense probably null
R2438:Zfp456 UTSW 13 67366954 missense probably damaging 1.00
R2516:Zfp456 UTSW 13 67362372 missense probably benign 0.00
R2896:Zfp456 UTSW 13 67367297 missense possibly damaging 0.52
R3964:Zfp456 UTSW 13 67366781 missense probably benign 0.03
R4930:Zfp456 UTSW 13 67366946 missense probably benign
R4971:Zfp456 UTSW 13 67366876 missense probably benign 0.31
R5357:Zfp456 UTSW 13 67372209 missense possibly damaging 0.71
R5795:Zfp456 UTSW 13 67366920 missense probably benign
R6339:Zfp456 UTSW 13 67362364 nonsense probably null
R6904:Zfp456 UTSW 13 67366265 missense probably benign 0.44
R7071:Zfp456 UTSW 13 67372777 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACAGTTCTGCTTTATGCCTGTAG -3'
(R):5'- TGTGAAGACTGTGGCAGATG -3'

Sequencing Primer
(F):5'- CACACTATAGAACACATTGGTTGGG -3'
(R):5'- TGCAAGTCTTCAGGAGCATC -3'
Posted On2016-11-21