Incidental Mutation 'R5754:Olfr1489'
ID444978
Institutional Source Beutler Lab
Gene Symbol Olfr1489
Ensembl Gene ENSMUSG00000045678
Gene Nameolfactory receptor 1489
SynonymsGA_x6K02T2RE5P-3965668-3966609, MOR202-19
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R5754 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location13631621-13643987 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13633993 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 294 (E294G)
Ref Sequence ENSEMBL: ENSMUSP00000149711 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053113] [ENSMUST00000217182]
Predicted Effect probably damaging
Transcript: ENSMUST00000053113
AA Change: E294G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000062444
Gene: ENSMUSG00000045678
AA Change: E294G

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.7e-53 PFAM
Pfam:7tm_1 39 289 1.2e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104103
Predicted Effect probably damaging
Transcript: ENSMUST00000217182
AA Change: E294G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Meta Mutation Damage Score 0.0248 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,269,541 S609P probably damaging Het
Abcb4 T A 5: 8,934,320 N683K probably benign Het
Atad2b T A 12: 5,010,351 H915Q probably benign Het
Camk1d G T 2: 5,445,097 P91Q probably benign Het
Camk1d G C 2: 5,445,099 S90R probably damaging Het
Card11 T C 5: 140,899,769 E345G probably damaging Het
Ccdc58 A G 16: 36,085,057 N63S probably benign Het
Ccpg1 G T 9: 73,013,244 V714L possibly damaging Het
Chst9 T C 18: 15,453,197 E103G possibly damaging Het
Cnga1 C T 5: 72,605,272 V300I probably benign Het
Crb1 T C 1: 139,231,599 Y1295C probably damaging Het
Dnah5 A G 15: 28,401,868 T3392A probably benign Het
Elp3 C A 14: 65,547,990 R473L probably damaging Het
Epgn T A 5: 91,033,948 I145N probably benign Het
Fam107b G A 2: 3,778,420 G220D probably damaging Het
Fbn2 A G 18: 58,124,311 V328A probably benign Het
Fn1 A T 1: 71,600,322 I1770N probably damaging Het
Fndc1 T A 17: 7,769,753 Y1159F unknown Het
Frem2 A G 3: 53,537,258 L2484P probably damaging Het
Grk2 C T 19: 4,290,468 R295H probably damaging Het
Gtf3c1 A T 7: 125,644,065 V1789D possibly damaging Het
Hmgcl T C 4: 135,950,587 V33A probably damaging Het
Ighv7-1 A G 12: 113,896,619 F51S probably damaging Het
Kcna6 A G 6: 126,739,725 L67P probably damaging Het
Lamc1 A T 1: 153,247,284 V720E probably benign Het
Lrch1 T C 14: 74,817,118 D312G probably damaging Het
Nav2 A G 7: 49,557,046 T1540A probably damaging Het
Nisch A T 14: 31,191,416 probably benign Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Npc1l1 A G 11: 6,227,839 Y524H probably damaging Het
Nrap T C 19: 56,389,484 T25A possibly damaging Het
Nusap1 A G 2: 119,647,099 K363R probably damaging Het
Olfr1019 T C 2: 85,841,312 T160A probably damaging Het
Olfr873 T A 9: 20,301,094 L298Q probably damaging Het
Pde4d T C 13: 109,938,013 I384T probably damaging Het
Pkhd1 T A 1: 20,523,651 R1413* probably null Het
Plcd3 T A 11: 103,073,766 Y593F possibly damaging Het
Plxna1 A T 6: 89,333,105 I1026N possibly damaging Het
Podxl T A 6: 31,524,394 I409F probably damaging Het
Polq A C 16: 37,017,263 Q179P probably benign Het
Pomt1 T C 2: 32,247,590 V401A probably damaging Het
Qdpr C T 5: 45,439,385 G146S probably damaging Het
Shc4 T A 2: 125,670,298 Q2L probably damaging Het
Skint8 T A 4: 111,950,190 C358S probably benign Het
Smc5 T C 19: 23,244,103 E354G possibly damaging Het
Snx30 T C 4: 59,868,275 V129A probably damaging Het
Sp110 G C 1: 85,577,202 probably benign Het
Spag6 T A 2: 18,698,802 probably benign Het
Trim28 T A 7: 13,029,109 Y450N probably benign Het
Trip11 C T 12: 101,885,665 W428* probably null Het
Umodl1 T A 17: 30,994,787 V966E probably damaging Het
Utf1 A G 7: 139,944,791 probably benign Het
Vmn1r72 T C 7: 11,669,849 Y224C probably damaging Het
Whrn A G 4: 63,416,588 S748P probably damaging Het
Zbtb41 T A 1: 139,432,078 probably null Het
Zfhx3 T C 8: 108,800,332 F954L probably damaging Het
Zfp456 A T 13: 67,366,240 I449K probably benign Het
Other mutations in Olfr1489
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Olfr1489 APN 19 13633539 missense probably benign 0.25
IGL03052:Olfr1489 UTSW 19 13633726 missense probably benign 0.00
R0179:Olfr1489 UTSW 19 13633140 missense probably damaging 1.00
R0270:Olfr1489 UTSW 19 13633684 missense probably damaging 1.00
R0633:Olfr1489 UTSW 19 13633336 missense probably damaging 0.99
R4466:Olfr1489 UTSW 19 13633437 missense probably damaging 0.97
R4884:Olfr1489 UTSW 19 13634027 missense probably benign 0.14
R5247:Olfr1489 UTSW 19 13633414 missense probably damaging 1.00
R5332:Olfr1489 UTSW 19 13633365 missense possibly damaging 0.91
R6165:Olfr1489 UTSW 19 13633143 missense possibly damaging 0.93
R6165:Olfr1489 UTSW 19 13633588 missense probably benign 0.02
R6221:Olfr1489 UTSW 19 13633466 nonsense probably null
R6486:Olfr1489 UTSW 19 13633691 missense probably damaging 1.00
R7008:Olfr1489 UTSW 19 13633621 missense probably damaging 1.00
R7076:Olfr1489 UTSW 19 13633880 missense possibly damaging 0.95
R7539:Olfr1489 UTSW 19 13633569 nonsense probably null
Z1088:Olfr1489 UTSW 19 13633453 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCAATCTTGAGGATGCGTTC -3'
(R):5'- AGAAGGGGCTTCATCTATGAAATACC -3'

Sequencing Primer
(F):5'- AGAAGGCCATTTCCACCTGTG -3'
(R):5'- GGGCTTCATCTATGAAATACCTATTC -3'
Posted On2016-11-21