Incidental Mutation 'R5755:Erbb4'
ID444982
Institutional Source Beutler Lab
Gene Symbol Erbb4
Ensembl Gene ENSMUSG00000062209
Gene Nameerb-b2 receptor tyrosine kinase 4
SynonymsHer4, ErbB4
MMRRC Submission 043202-MU
Accession Numbers

Ncbi RefSeq: NM_010154.1; MGI:104771

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5755 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location68032186-69108059 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 68560519 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 133 (E133G)
Ref Sequence ENSEMBL: ENSMUSP00000115373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119142] [ENSMUST00000121473] [ENSMUST00000153432]
Predicted Effect possibly damaging
Transcript: ENSMUST00000119142
AA Change: E133G

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112713
Gene: ENSMUSG00000062209
AA Change: E133G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 5e-34 PFAM
FU 183 223 2.07e1 SMART
FU 226 268 5.78e-10 SMART
Pfam:Recep_L_domain 358 478 1e-29 PFAM
FU 493 544 6.45e-8 SMART
FU 549 599 3.51e-9 SMART
FU 611 659 2.32e0 SMART
TyrKc 718 974 7.53e-133 SMART
low complexity region 1007 1023 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000121473
AA Change: E133G

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000114123
Gene: ENSMUSG00000062209
AA Change: E133G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 1.6e-34 PFAM
FU 183 223 2.07e1 SMART
FU 226 268 5.78e-10 SMART
Pfam:Recep_L_domain 358 478 5.5e-29 PFAM
FU 493 544 6.45e-8 SMART
FU 549 599 3.51e-9 SMART
FU 611 659 2.32e0 SMART
TyrKc 718 974 7.53e-133 SMART
low complexity region 1007 1023 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000153432
AA Change: E133G

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000115373
Gene: ENSMUSG00000062209
AA Change: E133G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 1.7e-34 PFAM
FU 183 223 2.07e1 SMART
FU 226 268 5.78e-10 SMART
Pfam:Recep_L_domain 358 478 5.7e-29 PFAM
FU 493 544 6.45e-8 SMART
FU 549 599 3.51e-9 SMART
FU 611 649 2.98e0 SMART
PDB:2R4B|B 680 732 1e-25 PDB
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype Strain: 1929607
Lethality: E10-E11
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Tyr protein kinase family and the epidermal growth factor receptor subfamily. It encodes a single-pass type I membrane protein with multiple cysteine rich domains, a transmembrane domain, a tyrosine kinase domain, a phosphotidylinositol-3 kinase binding site and a PDZ domain binding motif. The protein binds to and is activated by neuregulins and other factors and induces a variety of cellular responses including mitogenesis and differentiation. Multiple proteolytic events allow for the release of a cytoplasmic fragment and an extracellular fragment. Mutations in this gene have been associated with cancer. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit cardiac defects, alterations in hindbrain development, and midgestational lethality. Heterozygotes show schizophrenia-like behavior. Genetically rescued females show mammary defects. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(6) Gene trapped(1)

Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,398,454 F1042I probably damaging Het
Ahnak A G 19: 9,001,732 T127A probably benign Het
Aloxe3 A G 11: 69,132,749 I233V probably benign Het
Ambn T A 5: 88,464,491 probably null Het
Atp2b1 T C 10: 98,994,809 probably null Het
Atp2b1 A G 10: 99,003,170 E39G probably damaging Het
Camsap2 C T 1: 136,282,327 G476R probably damaging Het
Ccdc144b A T 3: 36,017,693 M501K probably benign Het
Cdk4 T A 10: 127,064,722 probably null Het
Dcaf12 T C 4: 41,313,356 Y63C probably damaging Het
Dtna T A 18: 23,621,463 S445T probably benign Het
Ehmt2 T C 17: 34,908,238 M109T probably benign Het
F830016B08Rik T A 18: 60,300,806 F320L probably damaging Het
Fyco1 A G 9: 123,828,708 V801A possibly damaging Het
Jag1 T A 2: 137,088,690 N674Y probably damaging Het
Kcnj10 A G 1: 172,369,594 E225G possibly damaging Het
Klhl11 T A 11: 100,464,351 M215L probably benign Het
Kmt2d G T 15: 98,863,646 P608T unknown Het
Map3k19 T C 1: 127,822,381 M1078V probably benign Het
Neto1 T C 18: 86,499,094 V512A probably damaging Het
Notch1 T C 2: 26,473,692 D910G probably benign Het
Olfr263 T A 13: 21,133,525 I250K probably damaging Het
Olfr378 T A 11: 73,425,731 N84I probably benign Het
Parvg T C 15: 84,331,096 probably null Het
Pi4kb A T 3: 94,994,297 probably null Het
Plag1 T C 4: 3,904,492 K233R possibly damaging Het
Rasgrp3 A C 17: 75,524,945 D587A probably benign Het
Slc7a10 A T 7: 35,198,911 I336F probably damaging Het
Snx8 T G 5: 140,353,041 E254A possibly damaging Het
Sp3 A T 2: 72,938,381 silent Het
Sp8 G T 12: 118,849,087 A226S probably damaging Het
Spata31d1c C A 13: 65,036,527 Q628K probably benign Het
Styx C A 14: 45,368,453 T138K probably benign Het
Syngr3 A G 17: 24,686,535 F155S probably damaging Het
Trip11 C T 12: 101,885,665 W428* probably null Het
Ubr4 A G 4: 139,460,095 T3825A possibly damaging Het
Vmn2r113 A T 17: 22,957,981 T580S probably benign Het
Zbtb11 T A 16: 56,000,713 S724R probably benign Het
Zcchc4 T C 5: 52,816,169 S379P probably benign Het
Znrd1 T A 17: 36,958,157 D43V probably benign Het
Other mutations in Erbb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Erbb4 APN 1 68071630 nonsense probably null
IGL01020:Erbb4 APN 1 68298449 splice site probably benign
IGL01349:Erbb4 APN 1 68346593 missense probably benign 0.00
IGL01386:Erbb4 APN 1 68343931 missense probably damaging 1.00
IGL01516:Erbb4 APN 1 68328245 nonsense probably null
IGL01536:Erbb4 APN 1 68290282 missense probably benign 0.00
IGL01721:Erbb4 APN 1 68254563 missense possibly damaging 0.46
IGL01832:Erbb4 APN 1 68254566 missense possibly damaging 0.84
IGL02002:Erbb4 APN 1 68080726 missense probably damaging 1.00
IGL02040:Erbb4 APN 1 68042535 missense probably damaging 1.00
IGL02371:Erbb4 APN 1 68290294 missense probably benign 0.00
IGL02399:Erbb4 APN 1 68042437 splice site probably benign
IGL02553:Erbb4 APN 1 68305864 missense probably benign 0.17
IGL03118:Erbb4 APN 1 68042719 missense probably benign 0.11
IGL03329:Erbb4 APN 1 68328122 missense probably benign 0.30
IGL03405:Erbb4 APN 1 68330238 missense probably benign 0.02
earthworm UTSW 1 68250580 missense possibly damaging 0.67
excrescence UTSW 1 68330246 missense probably damaging 1.00
Mole UTSW 1 68560576 missense probably damaging 1.00
P0018:Erbb4 UTSW 1 68071676 missense probably benign 0.05
PIT4480001:Erbb4 UTSW 1 68075543 missense probably damaging 1.00
R0193:Erbb4 UTSW 1 68043960 intron probably benign
R0329:Erbb4 UTSW 1 68298280 splice site probably benign
R0335:Erbb4 UTSW 1 68259259 missense probably benign
R0362:Erbb4 UTSW 1 68330270 missense probably damaging 0.99
R0579:Erbb4 UTSW 1 68042462 missense probably benign 0.17
R0730:Erbb4 UTSW 1 68259290 missense probably damaging 0.98
R1029:Erbb4 UTSW 1 68309614 missense probably damaging 0.96
R1444:Erbb4 UTSW 1 68254600 missense probably damaging 1.00
R1469:Erbb4 UTSW 1 68560682 missense probably damaging 0.99
R1469:Erbb4 UTSW 1 68560682 missense probably damaging 0.99
R1503:Erbb4 UTSW 1 68346546 missense probably benign 0.00
R1523:Erbb4 UTSW 1 68396252 missense possibly damaging 0.95
R1528:Erbb4 UTSW 1 68078582 nonsense probably null
R1604:Erbb4 UTSW 1 68346569 missense possibly damaging 0.88
R1611:Erbb4 UTSW 1 68040388 missense probably damaging 1.00
R1642:Erbb4 UTSW 1 68331234 missense probably damaging 1.00
R1905:Erbb4 UTSW 1 68075410 splice site probably benign
R1929:Erbb4 UTSW 1 68198888 missense probably damaging 0.98
R2046:Erbb4 UTSW 1 68298323 missense probably benign 0.02
R2139:Erbb4 UTSW 1 68346629 missense probably damaging 0.96
R2271:Erbb4 UTSW 1 68198888 missense probably damaging 0.98
R2298:Erbb4 UTSW 1 68042531 missense probably damaging 1.00
R2356:Erbb4 UTSW 1 68078596 missense probably benign 0.00
R3821:Erbb4 UTSW 1 68305913 missense probably damaging 0.97
R4007:Erbb4 UTSW 1 68740401 missense probably damaging 1.00
R4012:Erbb4 UTSW 1 68560576 missense probably damaging 1.00
R4077:Erbb4 UTSW 1 68040337 missense probably benign 0.07
R4196:Erbb4 UTSW 1 68343855 missense possibly damaging 0.90
R4536:Erbb4 UTSW 1 68346622 missense probably damaging 1.00
R4561:Erbb4 UTSW 1 68343921 nonsense probably null
R4642:Erbb4 UTSW 1 68250632 missense probably damaging 1.00
R4737:Erbb4 UTSW 1 68343900 missense probably damaging 0.98
R4739:Erbb4 UTSW 1 68343900 missense probably damaging 0.98
R4780:Erbb4 UTSW 1 68298314 missense probably damaging 1.00
R4801:Erbb4 UTSW 1 68330246 missense probably damaging 1.00
R4802:Erbb4 UTSW 1 68330246 missense probably damaging 1.00
R4811:Erbb4 UTSW 1 68254544 missense probably damaging 1.00
R4832:Erbb4 UTSW 1 68330238 missense probably benign 0.02
R5068:Erbb4 UTSW 1 68043902 splice site probably null
R5546:Erbb4 UTSW 1 68298293 missense probably damaging 0.99
R6189:Erbb4 UTSW 1 68043916 missense probably benign
R6257:Erbb4 UTSW 1 68396273 missense probably damaging 1.00
R6276:Erbb4 UTSW 1 68560576 missense probably damaging 1.00
R6521:Erbb4 UTSW 1 68042530 missense probably damaging 1.00
R6602:Erbb4 UTSW 1 68370503 missense probably damaging 0.99
R6808:Erbb4 UTSW 1 68040303 missense probably benign 0.00
R7087:Erbb4 UTSW 1 68740491 missense probably null 1.00
R7215:Erbb4 UTSW 1 68339460 missense probably benign
R7356:Erbb4 UTSW 1 68339355 critical splice donor site probably null
R7509:Erbb4 UTSW 1 68250580 missense possibly damaging 0.67
R7593:Erbb4 UTSW 1 68254599 missense probably damaging 0.99
R7743:Erbb4 UTSW 1 68328119 missense probably benign 0.00
R7784:Erbb4 UTSW 1 68075499 missense probably damaging 1.00
R7815:Erbb4 UTSW 1 68042726 missense probably damaging 1.00
R7923:Erbb4 UTSW 1 68259209 missense probably damaging 1.00
R8071:Erbb4 UTSW 1 68396311 missense probably damaging 1.00
R8288:Erbb4 UTSW 1 68298350 missense probably damaging 1.00
R8356:Erbb4 UTSW 1 68071630 missense probably damaging 1.00
R8456:Erbb4 UTSW 1 68071630 missense probably damaging 1.00
R8464:Erbb4 UTSW 1 68309626 missense probably benign
R8783:Erbb4 UTSW 1 68040172 missense possibly damaging 0.95
R8830:Erbb4 UTSW 1 68075468 missense probably damaging 1.00
R8881:Erbb4 UTSW 1 68343838 critical splice donor site probably null
X0019:Erbb4 UTSW 1 68073145 missense probably benign 0.00
Z1176:Erbb4 UTSW 1 68298402 frame shift probably null
Z1176:Erbb4 UTSW 1 68328259 nonsense probably null
Z1177:Erbb4 UTSW 1 68259183 frame shift probably null
Z1177:Erbb4 UTSW 1 68290476 missense probably damaging 1.00
Z1177:Erbb4 UTSW 1 68309643 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AGAGTGTACTTCTGTTCAGCTG -3'
(R):5'- ATGTTTTCCCAGTCTATCCGAG -3'

Sequencing Primer
(F):5'- TGCTATCTTTTACACAGCACTTG -3'
(R):5'- GTCTATCCGAGAAGTCACAGGC -3'
Posted On2016-11-21