Incidental Mutation 'R5755:Ccdc144b'
ID444988
Institutional Source Beutler Lab
Gene Symbol Ccdc144b
Ensembl Gene ENSMUSG00000047696
Gene Namecoiled-coil domain containing 144B
Synonyms
MMRRC Submission 043202-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R5755 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location36007244-36053547 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 36017693 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 501 (M501K)
Ref Sequence ENSEMBL: ENSMUSP00000142910 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166644] [ENSMUST00000196964] [ENSMUST00000200469]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124469
Predicted Effect probably benign
Transcript: ENSMUST00000166644
AA Change: M501K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000132995
Gene: ENSMUSG00000047696
AA Change: M501K

DomainStartEndE-ValueType
coiled coil region 65 97 N/A INTRINSIC
coiled coil region 121 166 N/A INTRINSIC
coiled coil region 231 327 N/A INTRINSIC
Pfam:DUF3496 381 488 1.6e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196964
SMART Domains Protein: ENSMUSP00000142406
Gene: ENSMUSG00000047696

DomainStartEndE-ValueType
coiled coil region 65 97 N/A INTRINSIC
coiled coil region 121 166 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200469
AA Change: M501K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000142910
Gene: ENSMUSG00000047696
AA Change: M501K

DomainStartEndE-ValueType
coiled coil region 65 97 N/A INTRINSIC
coiled coil region 121 166 N/A INTRINSIC
coiled coil region 231 327 N/A INTRINSIC
Pfam:DUF3496 381 488 1.6e-45 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,398,454 F1042I probably damaging Het
Ahnak A G 19: 9,001,732 T127A probably benign Het
Aloxe3 A G 11: 69,132,749 I233V probably benign Het
Ambn T A 5: 88,464,491 probably null Het
Atp2b1 T C 10: 98,994,809 probably null Het
Atp2b1 A G 10: 99,003,170 E39G probably damaging Het
Camsap2 C T 1: 136,282,327 G476R probably damaging Het
Cdk4 T A 10: 127,064,722 probably null Het
Dcaf12 T C 4: 41,313,356 Y63C probably damaging Het
Dtna T A 18: 23,621,463 S445T probably benign Het
Ehmt2 T C 17: 34,908,238 M109T probably benign Het
Erbb4 T C 1: 68,560,519 E133G possibly damaging Het
F830016B08Rik T A 18: 60,300,806 F320L probably damaging Het
Fyco1 A G 9: 123,828,708 V801A possibly damaging Het
Jag1 T A 2: 137,088,690 N674Y probably damaging Het
Kcnj10 A G 1: 172,369,594 E225G possibly damaging Het
Klhl11 T A 11: 100,464,351 M215L probably benign Het
Kmt2d G T 15: 98,863,646 P608T unknown Het
Map3k19 T C 1: 127,822,381 M1078V probably benign Het
Neto1 T C 18: 86,499,094 V512A probably damaging Het
Notch1 T C 2: 26,473,692 D910G probably benign Het
Olfr263 T A 13: 21,133,525 I250K probably damaging Het
Olfr378 T A 11: 73,425,731 N84I probably benign Het
Parvg T C 15: 84,331,096 probably null Het
Pi4kb A T 3: 94,994,297 probably null Het
Plag1 T C 4: 3,904,492 K233R possibly damaging Het
Rasgrp3 A C 17: 75,524,945 D587A probably benign Het
Slc7a10 A T 7: 35,198,911 I336F probably damaging Het
Snx8 T G 5: 140,353,041 E254A possibly damaging Het
Sp3 A T 2: 72,938,381 silent Het
Sp8 G T 12: 118,849,087 A226S probably damaging Het
Spata31d1c C A 13: 65,036,527 Q628K probably benign Het
Styx C A 14: 45,368,453 T138K probably benign Het
Syngr3 A G 17: 24,686,535 F155S probably damaging Het
Trip11 C T 12: 101,885,665 W428* probably null Het
Ubr4 A G 4: 139,460,095 T3825A possibly damaging Het
Vmn2r113 A T 17: 22,957,981 T580S probably benign Het
Zbtb11 T A 16: 56,000,713 S724R probably benign Het
Zcchc4 T C 5: 52,816,169 S379P probably benign Het
Znrd1 T A 17: 36,958,157 D43V probably benign Het
Other mutations in Ccdc144b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00570:Ccdc144b APN 3 36019989 missense probably damaging 1.00
IGL00773:Ccdc144b APN 3 36035337 missense probably damaging 1.00
IGL01409:Ccdc144b APN 3 36025928 missense possibly damaging 0.77
IGL01791:Ccdc144b APN 3 36035267 critical splice donor site probably benign 0.00
IGL02307:Ccdc144b APN 3 36018867 missense possibly damaging 0.95
IGL02374:Ccdc144b APN 3 36019959 missense possibly damaging 0.83
IGL02673:Ccdc144b APN 3 36046699 splice site probably benign
IGL02727:Ccdc144b APN 3 36032916 missense possibly damaging 0.66
R0355:Ccdc144b UTSW 3 36046905 splice site probably benign
R0833:Ccdc144b UTSW 3 36020213 splice site probably benign
R0928:Ccdc144b UTSW 3 36025366 missense possibly damaging 0.83
R1595:Ccdc144b UTSW 3 36018997 missense probably damaging 0.99
R1598:Ccdc144b UTSW 3 36018997 missense probably damaging 0.99
R2011:Ccdc144b UTSW 3 36010678 nonsense probably null
R2255:Ccdc144b UTSW 3 36019950 missense probably benign 0.00
R2921:Ccdc144b UTSW 3 36025928 missense probably null 0.01
R4659:Ccdc144b UTSW 3 36025954 missense possibly damaging 0.90
R4764:Ccdc144b UTSW 3 36010660 makesense probably null
R4929:Ccdc144b UTSW 3 36035338 missense probably damaging 0.99
R5631:Ccdc144b UTSW 3 36046877 missense probably damaging 0.99
R5849:Ccdc144b UTSW 3 36032877 missense possibly damaging 0.81
R5894:Ccdc144b UTSW 3 36019975 missense possibly damaging 0.91
R5968:Ccdc144b UTSW 3 36010691 missense probably benign 0.00
R6961:Ccdc144b UTSW 3 36050617 missense possibly damaging 0.66
R6963:Ccdc144b UTSW 3 36050662 missense probably benign 0.30
R7248:Ccdc144b UTSW 3 36025937 missense probably benign 0.00
R7380:Ccdc144b UTSW 3 36025921 missense possibly damaging 0.68
R7462:Ccdc144b UTSW 3 36025906 splice site probably null
R7612:Ccdc144b UTSW 3 36025357 missense possibly damaging 0.79
R7637:Ccdc144b UTSW 3 36046876 missense probably damaging 0.98
R8025:Ccdc144b UTSW 3 36018987 missense probably damaging 0.97
X0011:Ccdc144b UTSW 3 36025948 missense possibly damaging 0.66
X0057:Ccdc144b UTSW 3 36018901 nonsense probably null
Z1176:Ccdc144b UTSW 3 36018888 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TCAAGTCAGCAAATGAGTATGGC -3'
(R):5'- AAACCAAACTTCTCCTGGAGAG -3'

Sequencing Primer
(F):5'- CAGCAAATGAGTATGGCTTGTAAATG -3'
(R):5'- CTCCTGGAGAGAAAACAGTACCG -3'
Posted On2016-11-21