Incidental Mutation 'R5755:Klhl11'
ID445004
Institutional Source Beutler Lab
Gene Symbol Klhl11
Ensembl Gene ENSMUSG00000048732
Gene Namekelch-like 11
Synonyms
MMRRC Submission 043202-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.705) question?
Stock #R5755 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location100462614-100472741 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 100464351 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 215 (M215L)
Ref Sequence ENSEMBL: ENSMUSP00000054963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056665]
Predicted Effect probably benign
Transcript: ENSMUST00000056665
AA Change: M215L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000054963
Gene: ENSMUSG00000048732
AA Change: M215L

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
BTB 95 201 2.69e-21 SMART
BACK 206 308 9.54e-26 SMART
Kelch 361 408 4.1e0 SMART
Kelch 409 454 2.61e-1 SMART
Kelch 455 502 2.17e-1 SMART
Kelch 611 662 1.39e-2 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,398,454 F1042I probably damaging Het
Ahnak A G 19: 9,001,732 T127A probably benign Het
Aloxe3 A G 11: 69,132,749 I233V probably benign Het
Ambn T A 5: 88,464,491 probably null Het
Atp2b1 T C 10: 98,994,809 probably null Het
Atp2b1 A G 10: 99,003,170 E39G probably damaging Het
Camsap2 C T 1: 136,282,327 G476R probably damaging Het
Ccdc144b A T 3: 36,017,693 M501K probably benign Het
Cdk4 T A 10: 127,064,722 probably null Het
Dcaf12 T C 4: 41,313,356 Y63C probably damaging Het
Dtna T A 18: 23,621,463 S445T probably benign Het
Ehmt2 T C 17: 34,908,238 M109T probably benign Het
Erbb4 T C 1: 68,560,519 E133G possibly damaging Het
F830016B08Rik T A 18: 60,300,806 F320L probably damaging Het
Fyco1 A G 9: 123,828,708 V801A possibly damaging Het
Jag1 T A 2: 137,088,690 N674Y probably damaging Het
Kcnj10 A G 1: 172,369,594 E225G possibly damaging Het
Kmt2d G T 15: 98,863,646 P608T unknown Het
Map3k19 T C 1: 127,822,381 M1078V probably benign Het
Neto1 T C 18: 86,499,094 V512A probably damaging Het
Notch1 T C 2: 26,473,692 D910G probably benign Het
Olfr263 T A 13: 21,133,525 I250K probably damaging Het
Olfr378 T A 11: 73,425,731 N84I probably benign Het
Parvg T C 15: 84,331,096 probably null Het
Pi4kb A T 3: 94,994,297 probably null Het
Plag1 T C 4: 3,904,492 K233R possibly damaging Het
Rasgrp3 A C 17: 75,524,945 D587A probably benign Het
Slc7a10 A T 7: 35,198,911 I336F probably damaging Het
Snx8 T G 5: 140,353,041 E254A possibly damaging Het
Sp3 A T 2: 72,938,381 silent Het
Sp8 G T 12: 118,849,087 A226S probably damaging Het
Spata31d1c C A 13: 65,036,527 Q628K probably benign Het
Styx C A 14: 45,368,453 T138K probably benign Het
Syngr3 A G 17: 24,686,535 F155S probably damaging Het
Trip11 C T 12: 101,885,665 W428* probably null Het
Ubr4 A G 4: 139,460,095 T3825A possibly damaging Het
Vmn2r113 A T 17: 22,957,981 T580S probably benign Het
Zbtb11 T A 16: 56,000,713 S724R probably benign Het
Zcchc4 T C 5: 52,816,169 S379P probably benign Het
Znrd1 T A 17: 36,958,157 D43V probably benign Het
Other mutations in Klhl11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Klhl11 APN 11 100463205 missense possibly damaging 0.94
IGL02334:Klhl11 APN 11 100463836 missense probably damaging 1.00
IGL02886:Klhl11 APN 11 100472221 missense possibly damaging 0.92
R0372:Klhl11 UTSW 11 100463522 missense probably damaging 0.97
R0583:Klhl11 UTSW 11 100464324 missense possibly damaging 0.57
R0608:Klhl11 UTSW 11 100472242 missense probably damaging 1.00
R0609:Klhl11 UTSW 11 100463714 missense probably damaging 1.00
R1417:Klhl11 UTSW 11 100472289 missense probably benign 0.00
R1629:Klhl11 UTSW 11 100464186 missense probably benign 0.00
R1643:Klhl11 UTSW 11 100463015 missense probably benign 0.09
R1985:Klhl11 UTSW 11 100463244 missense probably benign 0.00
R3844:Klhl11 UTSW 11 100472307 missense possibly damaging 0.84
R4746:Klhl11 UTSW 11 100464350 missense probably benign 0.00
R5053:Klhl11 UTSW 11 100472200 missense probably damaging 1.00
R5426:Klhl11 UTSW 11 100464116 missense probably damaging 1.00
R5731:Klhl11 UTSW 11 100463763 missense probably damaging 1.00
R6874:Klhl11 UTSW 11 100472205 missense probably benign 0.00
R7295:Klhl11 UTSW 11 100472242 missense probably damaging 1.00
R7426:Klhl11 UTSW 11 100464352 missense probably benign 0.17
R7554:Klhl11 UTSW 11 100463948 missense probably benign
R8125:Klhl11 UTSW 11 100463985 missense probably benign
R8145:Klhl11 UTSW 11 100463914 missense probably damaging 0.99
Z1177:Klhl11 UTSW 11 100463966 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- CTGAACCCACTTCAAAACTGTTTC -3'
(R):5'- TGCTAATTTGCAGAGGGAGG -3'

Sequencing Primer
(F):5'- ACTGTTTCAAAAAGAACCTCTTCAG -3'
(R):5'- CTAATTTGCAGAGGGAGGGTAGTC -3'
Posted On2016-11-21