Incidental Mutation 'R5755:Spata31d1c'
ID445008
Institutional Source Beutler Lab
Gene Symbol Spata31d1c
Ensembl Gene ENSMUSG00000074849
Gene Namespermatogenesis associated 31 subfamily D, member 1C
Synonyms4932441B19Rik, Fam75d1c
MMRRC Submission 043202-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5755 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location65033058-65038004 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 65036527 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 628 (Q628K)
Ref Sequence ENSEMBL: ENSMUSP00000097024 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099427]
Predicted Effect probably benign
Transcript: ENSMUST00000099427
AA Change: Q628K

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000097024
Gene: ENSMUSG00000074849
AA Change: Q628K

DomainStartEndE-ValueType
transmembrane domain 22 44 N/A INTRINSIC
Pfam:DUF4599 63 148 2.4e-31 PFAM
low complexity region 178 190 N/A INTRINSIC
low complexity region 196 213 N/A INTRINSIC
low complexity region 218 233 N/A INTRINSIC
low complexity region 237 251 N/A INTRINSIC
Pfam:FAM75 380 742 1.4e-120 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,398,454 F1042I probably damaging Het
Ahnak A G 19: 9,001,732 T127A probably benign Het
Aloxe3 A G 11: 69,132,749 I233V probably benign Het
Ambn T A 5: 88,464,491 probably null Het
Atp2b1 T C 10: 98,994,809 probably null Het
Atp2b1 A G 10: 99,003,170 E39G probably damaging Het
Camsap2 C T 1: 136,282,327 G476R probably damaging Het
Ccdc144b A T 3: 36,017,693 M501K probably benign Het
Cdk4 T A 10: 127,064,722 probably null Het
Dcaf12 T C 4: 41,313,356 Y63C probably damaging Het
Dtna T A 18: 23,621,463 S445T probably benign Het
Ehmt2 T C 17: 34,908,238 M109T probably benign Het
Erbb4 T C 1: 68,560,519 E133G possibly damaging Het
F830016B08Rik T A 18: 60,300,806 F320L probably damaging Het
Fyco1 A G 9: 123,828,708 V801A possibly damaging Het
Jag1 T A 2: 137,088,690 N674Y probably damaging Het
Kcnj10 A G 1: 172,369,594 E225G possibly damaging Het
Klhl11 T A 11: 100,464,351 M215L probably benign Het
Kmt2d G T 15: 98,863,646 P608T unknown Het
Map3k19 T C 1: 127,822,381 M1078V probably benign Het
Neto1 T C 18: 86,499,094 V512A probably damaging Het
Notch1 T C 2: 26,473,692 D910G probably benign Het
Olfr263 T A 13: 21,133,525 I250K probably damaging Het
Olfr378 T A 11: 73,425,731 N84I probably benign Het
Parvg T C 15: 84,331,096 probably null Het
Pi4kb A T 3: 94,994,297 probably null Het
Plag1 T C 4: 3,904,492 K233R possibly damaging Het
Rasgrp3 A C 17: 75,524,945 D587A probably benign Het
Slc7a10 A T 7: 35,198,911 I336F probably damaging Het
Snx8 T G 5: 140,353,041 E254A possibly damaging Het
Sp3 A T 2: 72,938,381 silent Het
Sp8 G T 12: 118,849,087 A226S probably damaging Het
Styx C A 14: 45,368,453 T138K probably benign Het
Syngr3 A G 17: 24,686,535 F155S probably damaging Het
Trip11 C T 12: 101,885,665 W428* probably null Het
Ubr4 A G 4: 139,460,095 T3825A possibly damaging Het
Vmn2r113 A T 17: 22,957,981 T580S probably benign Het
Zbtb11 T A 16: 56,000,713 S724R probably benign Het
Zcchc4 T C 5: 52,816,169 S379P probably benign Het
Znrd1 T A 17: 36,958,157 D43V probably benign Het
Other mutations in Spata31d1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01639:Spata31d1c APN 13 65036089 missense probably damaging 1.00
IGL02830:Spata31d1c APN 13 65035366 missense probably benign 0.25
IGL02947:Spata31d1c APN 13 65034945 nonsense probably null
IGL03133:Spata31d1c APN 13 65034985 missense probably benign 0.18
IGL03176:Spata31d1c APN 13 65037011 missense probably benign 0.01
IGL03183:Spata31d1c APN 13 65035195 missense possibly damaging 0.86
IGL03206:Spata31d1c APN 13 65035593 missense probably benign 0.41
PIT4382001:Spata31d1c UTSW 13 65036171 missense probably benign 0.01
R0054:Spata31d1c UTSW 13 65033062 start gained probably benign
R0959:Spata31d1c UTSW 13 65036315 missense probably damaging 1.00
R1232:Spata31d1c UTSW 13 65036614 missense probably benign
R1347:Spata31d1c UTSW 13 65035388 missense probably benign 0.00
R1381:Spata31d1c UTSW 13 65036554 missense probably benign 0.08
R1573:Spata31d1c UTSW 13 65035069 missense possibly damaging 0.92
R1582:Spata31d1c UTSW 13 65033224 missense probably benign
R1639:Spata31d1c UTSW 13 65036039 missense probably benign
R1716:Spata31d1c UTSW 13 65033216 missense possibly damaging 0.86
R1781:Spata31d1c UTSW 13 65036171 missense probably benign 0.01
R1907:Spata31d1c UTSW 13 65035876 missense probably benign 0.03
R2012:Spata31d1c UTSW 13 65035227 missense possibly damaging 0.91
R2152:Spata31d1c UTSW 13 65033965 critical splice donor site probably null
R2211:Spata31d1c UTSW 13 65035939 missense probably benign 0.04
R2571:Spata31d1c UTSW 13 65036384 missense probably damaging 1.00
R2908:Spata31d1c UTSW 13 65033191 missense possibly damaging 0.63
R3978:Spata31d1c UTSW 13 65035160 missense possibly damaging 0.61
R3979:Spata31d1c UTSW 13 65035160 missense possibly damaging 0.61
R3980:Spata31d1c UTSW 13 65035160 missense possibly damaging 0.61
R3981:Spata31d1c UTSW 13 65035111 missense possibly damaging 0.68
R4014:Spata31d1c UTSW 13 65035399 missense probably damaging 0.99
R4255:Spata31d1c UTSW 13 65035688 nonsense probably null
R4255:Spata31d1c UTSW 13 65035717 missense probably benign 0.04
R4592:Spata31d1c UTSW 13 65036060 missense probably damaging 0.99
R4597:Spata31d1c UTSW 13 65035613 nonsense probably null
R4624:Spata31d1c UTSW 13 65036597 missense probably benign
R4641:Spata31d1c UTSW 13 65035048 missense probably benign 0.01
R4863:Spata31d1c UTSW 13 65035790 nonsense probably null
R5084:Spata31d1c UTSW 13 65035130 missense probably damaging 0.98
R5152:Spata31d1c UTSW 13 65035595 missense probably damaging 1.00
R5230:Spata31d1c UTSW 13 65035434 missense probably benign 0.41
R5267:Spata31d1c UTSW 13 65035904 missense probably damaging 0.98
R5615:Spata31d1c UTSW 13 65035264 missense possibly damaging 0.61
R5935:Spata31d1c UTSW 13 65037080 missense possibly damaging 0.68
R6017:Spata31d1c UTSW 13 65035079 missense possibly damaging 0.91
R6131:Spata31d1c UTSW 13 65035671 missense probably benign 0.10
R6359:Spata31d1c UTSW 13 65035592 missense possibly damaging 0.63
R6723:Spata31d1c UTSW 13 65035944 missense probably benign 0.01
R7028:Spata31d1c UTSW 13 65036063 missense probably damaging 0.98
R7336:Spata31d1c UTSW 13 65036128 missense probably damaging 0.99
R7426:Spata31d1c UTSW 13 65035361 missense probably benign
R7552:Spata31d1c UTSW 13 65036123 missense probably damaging 0.98
R7605:Spata31d1c UTSW 13 65035840 missense probably benign 0.00
R7666:Spata31d1c UTSW 13 65036000 missense probably benign 0.01
R8403:Spata31d1c UTSW 13 65036230 missense probably benign 0.42
R8445:Spata31d1c UTSW 13 65033177 missense probably damaging 0.98
R8513:Spata31d1c UTSW 13 65033177 missense probably damaging 0.98
R8515:Spata31d1c UTSW 13 65033177 missense probably damaging 0.98
R8523:Spata31d1c UTSW 13 65033177 missense probably damaging 0.98
R8799:Spata31d1c UTSW 13 65036326 missense possibly damaging 0.92
R8817:Spata31d1c UTSW 13 65034562 missense probably damaging 0.98
R8854:Spata31d1c UTSW 13 65035990 missense possibly damaging 0.82
R8917:Spata31d1c UTSW 13 65035615 missense probably benign 0.02
X0022:Spata31d1c UTSW 13 65036927 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- AGCTCTCCAAGACCCATGTTC -3'
(R):5'- ATTGCAGGCCGTTATCTAGAG -3'

Sequencing Primer
(F):5'- TTTATCACCAGTGAGCTCCAGAAG -3'
(R):5'- AGAGTGCCCTTAGTGTTACTCCATG -3'
Posted On2016-11-21