Incidental Mutation 'R5755:Neto1'
ID445021
Institutional Source Beutler Lab
Gene Symbol Neto1
Ensembl Gene ENSMUSG00000050321
Gene Nameneuropilin (NRP) and tolloid (TLL)-like 1
SynonymsC130005O10Rik
MMRRC Submission 043202-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5755 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location86394952-86501897 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86499094 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 512 (V512A)
Ref Sequence ENSEMBL: ENSMUSP00000057340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058829]
Predicted Effect probably damaging
Transcript: ENSMUST00000058829
AA Change: V512A

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000057340
Gene: ENSMUSG00000050321
AA Change: V512A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CUB 41 155 2.06e-35 SMART
CUB 172 287 3.1e-7 SMART
LDLa 291 328 3.11e-3 SMART
transmembrane domain 341 363 N/A INTRINSIC
low complexity region 485 497 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a predicted transmembrane protein containing two extracellular CUB domains followed by a low-density lipoprotein class A (LDLa) domain. A similar gene in mice encodes a protein that plays a critical role in spatial learning and memory by regulating the function of synaptic N-methyl-D-aspartic acid receptor complexes in the hippocampus. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit depressed long term potentiation, reduced NMDAR excitatory postsynaptic potentiation, and decreased spartial learning and working memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,398,454 F1042I probably damaging Het
Ahnak A G 19: 9,001,732 T127A probably benign Het
Aloxe3 A G 11: 69,132,749 I233V probably benign Het
Ambn T A 5: 88,464,491 probably null Het
Atp2b1 T C 10: 98,994,809 probably null Het
Atp2b1 A G 10: 99,003,170 E39G probably damaging Het
Camsap2 C T 1: 136,282,327 G476R probably damaging Het
Ccdc144b A T 3: 36,017,693 M501K probably benign Het
Cdk4 T A 10: 127,064,722 probably null Het
Dcaf12 T C 4: 41,313,356 Y63C probably damaging Het
Dtna T A 18: 23,621,463 S445T probably benign Het
Ehmt2 T C 17: 34,908,238 M109T probably benign Het
Erbb4 T C 1: 68,560,519 E133G possibly damaging Het
F830016B08Rik T A 18: 60,300,806 F320L probably damaging Het
Fyco1 A G 9: 123,828,708 V801A possibly damaging Het
Jag1 T A 2: 137,088,690 N674Y probably damaging Het
Kcnj10 A G 1: 172,369,594 E225G possibly damaging Het
Klhl11 T A 11: 100,464,351 M215L probably benign Het
Kmt2d G T 15: 98,863,646 P608T unknown Het
Map3k19 T C 1: 127,822,381 M1078V probably benign Het
Notch1 T C 2: 26,473,692 D910G probably benign Het
Olfr263 T A 13: 21,133,525 I250K probably damaging Het
Olfr378 T A 11: 73,425,731 N84I probably benign Het
Parvg T C 15: 84,331,096 probably null Het
Pi4kb A T 3: 94,994,297 probably null Het
Plag1 T C 4: 3,904,492 K233R possibly damaging Het
Rasgrp3 A C 17: 75,524,945 D587A probably benign Het
Slc7a10 A T 7: 35,198,911 I336F probably damaging Het
Snx8 T G 5: 140,353,041 E254A possibly damaging Het
Sp3 A T 2: 72,938,381 silent Het
Sp8 G T 12: 118,849,087 A226S probably damaging Het
Spata31d1c C A 13: 65,036,527 Q628K probably benign Het
Styx C A 14: 45,368,453 T138K probably benign Het
Syngr3 A G 17: 24,686,535 F155S probably damaging Het
Trip11 C T 12: 101,885,665 W428* probably null Het
Ubr4 A G 4: 139,460,095 T3825A possibly damaging Het
Vmn2r113 A T 17: 22,957,981 T580S probably benign Het
Zbtb11 T A 16: 56,000,713 S724R probably benign Het
Zcchc4 T C 5: 52,816,169 S379P probably benign Het
Znrd1 T A 17: 36,958,157 D43V probably benign Het
Other mutations in Neto1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Neto1 APN 18 86498812 missense probably damaging 0.98
IGL01505:Neto1 APN 18 86473689 missense possibly damaging 0.82
IGL01511:Neto1 APN 18 86395908 missense possibly damaging 0.96
IGL02704:Neto1 APN 18 86473823 missense probably damaging 1.00
IGL03072:Neto1 APN 18 86498589 missense probably benign 0.23
R0119:Neto1 UTSW 18 86461320 missense probably benign 0.17
R0136:Neto1 UTSW 18 86461320 missense probably benign 0.17
R0299:Neto1 UTSW 18 86461320 missense probably benign 0.17
R0603:Neto1 UTSW 18 86473660 missense possibly damaging 0.95
R0633:Neto1 UTSW 18 86404729 nonsense probably null
R0657:Neto1 UTSW 18 86461320 missense probably benign 0.17
R1395:Neto1 UTSW 18 86398019 splice site probably benign
R1648:Neto1 UTSW 18 86500054 missense probably damaging 1.00
R1852:Neto1 UTSW 18 86395884 start codon destroyed probably null 0.53
R2249:Neto1 UTSW 18 86461274 missense probably benign 0.02
R4418:Neto1 UTSW 18 86404856 missense probably benign
R4476:Neto1 UTSW 18 86404673 missense probably damaging 0.98
R4676:Neto1 UTSW 18 86398302 missense possibly damaging 0.47
R5095:Neto1 UTSW 18 86398281 missense probably benign
R5282:Neto1 UTSW 18 86404873 missense probably damaging 1.00
R5337:Neto1 UTSW 18 86398309 missense probably benign 0.00
R5400:Neto1 UTSW 18 86395908 missense possibly damaging 0.86
R5435:Neto1 UTSW 18 86398263 missense probably benign 0.00
R5632:Neto1 UTSW 18 86498643 missense probably benign 0.00
R6272:Neto1 UTSW 18 86494815 missense probably damaging 1.00
R6486:Neto1 UTSW 18 86461246 missense probably benign
R6505:Neto1 UTSW 18 86498574 missense possibly damaging 0.81
R6526:Neto1 UTSW 18 86498748 missense possibly damaging 0.47
R6582:Neto1 UTSW 18 86494860 nonsense probably null
R6887:Neto1 UTSW 18 86498635 missense probably benign 0.16
R7452:Neto1 UTSW 18 86498931 missense probably benign
R7469:Neto1 UTSW 18 86498688 missense probably benign
R7795:Neto1 UTSW 18 86461073 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGGCAGTCGCAGTAACCTC -3'
(R):5'- CTGTGTGTACATGTGTCATTGCAC -3'

Sequencing Primer
(F):5'- GACGCTTCCATTTTGGCAGAGATAC -3'
(R):5'- GCACACGTGTATATTTCATGCTCATG -3'
Posted On2016-11-21