Incidental Mutation 'R5756:Tbx15'
ID 445034
Institutional Source Beutler Lab
Gene Symbol Tbx15
Ensembl Gene ENSMUSG00000027868
Gene Name T-box 15
Synonyms Tbx8, de, Tbx14
MMRRC Submission 043359-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.930) question?
Stock # R5756 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 99147697-99261575 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 99220402 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 165 (I165F)
Ref Sequence ENSEMBL: ENSMUSP00000029462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029462] [ENSMUST00000150756] [ENSMUST00000151606]
AlphaFold O70306
Predicted Effect probably damaging
Transcript: ENSMUST00000029462
AA Change: I165F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029462
Gene: ENSMUSG00000027868
AA Change: I165F

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
TBOX 112 309 8.05e-131 SMART
Blast:TBOX 310 482 8e-83 BLAST
low complexity region 486 492 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150756
AA Change: I59F

PolyPhen 2 Score 0.254 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000142358
Gene: ENSMUSG00000027868
AA Change: I59F

DomainStartEndE-ValueType
TBOX 6 142 2.4e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151606
SMART Domains Protein: ENSMUSP00000143417
Gene: ENSMUSG00000027868

DomainStartEndE-ValueType
Pfam:T-box 8 51 1.1e-17 PFAM
Meta Mutation Damage Score 0.1342 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the T-box family of genes, which encode a phylogenetically conserved family of transcription factors that regulate a variety of developmental processes. All these genes contain a common T-box DNA-binding domain. Mutations in this gene are associated with Cousin syndrome.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutants have low set ears that project laterally, skeletal abnormalities and distinctive dorsoventral coat color patterning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579C12Rik A G 9: 89,010,919 (GRCm39) noncoding transcript Het
Aqp6 A T 15: 99,500,623 (GRCm39) I183F probably damaging Het
Asap1 A T 15: 64,039,556 (GRCm39) M218K probably damaging Het
Astn2 G A 4: 66,037,425 (GRCm39) probably benign Het
Bmp5 A G 9: 75,683,649 (GRCm39) D92G probably benign Het
Cables1 A G 18: 12,074,410 (GRCm39) D511G probably damaging Het
Cacna1e A G 1: 154,347,383 (GRCm39) M928T probably benign Het
Calcoco1 T C 15: 102,628,086 (GRCm39) N16S probably benign Het
Catspere2 A T 1: 177,943,793 (GRCm39) Q710L unknown Het
Coro7 C T 16: 4,450,148 (GRCm39) R567Q probably damaging Het
Dgki C T 6: 36,913,993 (GRCm39) probably benign Het
Dusp11 T C 6: 85,929,339 (GRCm39) I147V probably damaging Het
Eif2ak4 T C 2: 118,293,221 (GRCm39) I1259T possibly damaging Het
Elapor2 A C 5: 9,512,995 (GRCm39) K996N probably damaging Het
Etfdh T C 3: 79,521,063 (GRCm39) I219V probably benign Het
Ffar4 C T 19: 38,102,406 (GRCm39) T347I probably damaging Het
Fgf3 G A 7: 144,396,688 (GRCm39) S234N probably benign Het
Fnta A T 8: 26,499,735 (GRCm39) I155N possibly damaging Het
Gcm2 G A 13: 41,263,372 (GRCm39) T20M probably damaging Het
Ggt5 A T 10: 75,440,607 (GRCm39) M243L probably benign Het
Ggta1 T C 2: 35,292,395 (GRCm39) Y304C probably damaging Het
Gm5454 A G 13: 103,492,855 (GRCm39) noncoding transcript Het
Gprc5c G T 11: 114,755,093 (GRCm39) V257L possibly damaging Het
Hrc T C 7: 44,986,130 (GRCm39) V427A possibly damaging Het
Ibtk C G 9: 85,613,307 (GRCm39) V219L possibly damaging Het
Ift140 A G 17: 25,247,787 (GRCm39) H215R possibly damaging Het
Itln1 A G 1: 171,344,485 (GRCm39) probably benign Het
Kif13b T C 14: 64,973,754 (GRCm39) I368T probably damaging Het
Lars2 T C 9: 123,267,264 (GRCm39) Y529H probably damaging Het
Lrrc55 G A 2: 85,026,727 (GRCm39) T99I probably benign Het
Mycbp2 A T 14: 103,371,410 (GRCm39) I4156N probably damaging Het
Myo1c T G 11: 75,549,240 (GRCm39) M137R probably benign Het
Or51i1 T C 7: 103,670,889 (GRCm39) D212G probably damaging Het
Or6c8b A G 10: 128,882,095 (GRCm39) V279A probably benign Het
Or8b54 T A 9: 38,686,554 (GRCm39) M1K probably null Het
Pde7a A G 3: 19,319,009 (GRCm39) V12A probably benign Het
Phyhip T G 14: 70,704,532 (GRCm39) C250W probably damaging Het
Pisd G A 5: 32,895,842 (GRCm39) T412I probably damaging Het
Polr3c T C 3: 96,621,450 (GRCm39) N444S probably damaging Het
Sart1 T C 19: 5,430,497 (GRCm39) E750G probably damaging Het
Sh3rf3 T C 10: 58,940,204 (GRCm39) V675A probably damaging Het
Slc4a11 G T 2: 130,529,783 (GRCm39) D307E probably benign Het
Slc6a16 A T 7: 44,910,274 (GRCm39) I315F possibly damaging Het
Smarca5 A C 8: 81,437,233 (GRCm39) S708A probably benign Het
Sv2c T C 13: 96,122,475 (GRCm39) I434V probably benign Het
Tars3 A G 7: 65,325,724 (GRCm39) K433E probably benign Het
Tep1 C T 14: 51,074,836 (GRCm39) probably null Het
Tex15 G A 8: 34,065,861 (GRCm39) G1764S probably benign Het
Tnfrsf19 A G 14: 61,262,224 (GRCm39) L13P probably benign Het
Tnnt3 G A 7: 142,056,495 (GRCm39) probably null Het
Ttc23l G T 15: 10,551,636 (GRCm39) T30K possibly damaging Het
Usp24 T A 4: 106,219,680 (GRCm39) I597K probably damaging Het
Usp40 C T 1: 87,879,413 (GRCm39) R960Q possibly damaging Het
Vps53 A T 11: 75,983,156 (GRCm39) probably benign Het
Xylt1 C T 7: 117,249,927 (GRCm39) T699I probably damaging Het
Zfp81 A C 17: 33,553,307 (GRCm39) Y502* probably null Het
Zfyve26 T A 12: 79,311,131 (GRCm39) H145L probably damaging Het
Other mutations in Tbx15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Tbx15 APN 3 99,223,562 (GRCm39) missense probably damaging 1.00
IGL01458:Tbx15 APN 3 99,223,544 (GRCm39) missense probably damaging 0.98
IGL01633:Tbx15 APN 3 99,220,358 (GRCm39) missense probably damaging 0.97
IGL02338:Tbx15 APN 3 99,259,800 (GRCm39) missense probably damaging 1.00
IGL02415:Tbx15 APN 3 99,259,826 (GRCm39) missense probably benign 0.01
IGL03143:Tbx15 APN 3 99,259,514 (GRCm39) missense possibly damaging 0.67
IGL03201:Tbx15 APN 3 99,259,296 (GRCm39) missense probably benign 0.00
shin_guard UTSW 3 99,259,508 (GRCm39) missense possibly damaging 0.90
Shortcut UTSW 3 99,220,389 (GRCm39) nonsense probably null
R0012:Tbx15 UTSW 3 99,259,412 (GRCm39) missense probably benign
R0109:Tbx15 UTSW 3 99,259,182 (GRCm39) missense possibly damaging 0.92
R0277:Tbx15 UTSW 3 99,259,707 (GRCm39) missense probably damaging 1.00
R0462:Tbx15 UTSW 3 99,223,634 (GRCm39) missense probably damaging 1.00
R1134:Tbx15 UTSW 3 99,223,639 (GRCm39) missense probably damaging 0.98
R1347:Tbx15 UTSW 3 99,259,427 (GRCm39) missense possibly damaging 0.92
R1347:Tbx15 UTSW 3 99,259,427 (GRCm39) missense possibly damaging 0.92
R1506:Tbx15 UTSW 3 99,259,228 (GRCm39) missense possibly damaging 0.80
R1681:Tbx15 UTSW 3 99,259,140 (GRCm39) splice site probably null
R1762:Tbx15 UTSW 3 99,259,260 (GRCm39) nonsense probably null
R1789:Tbx15 UTSW 3 99,259,562 (GRCm39) nonsense probably null
R2167:Tbx15 UTSW 3 99,233,771 (GRCm39) splice site probably benign
R2254:Tbx15 UTSW 3 99,259,190 (GRCm39) missense possibly damaging 0.52
R2357:Tbx15 UTSW 3 99,223,672 (GRCm39) splice site probably null
R2441:Tbx15 UTSW 3 99,259,827 (GRCm39) missense probably damaging 0.99
R3010:Tbx15 UTSW 3 99,161,209 (GRCm39) intron probably benign
R3118:Tbx15 UTSW 3 99,259,470 (GRCm39) missense probably damaging 0.96
R4081:Tbx15 UTSW 3 99,220,370 (GRCm39) missense possibly damaging 0.92
R4610:Tbx15 UTSW 3 99,259,683 (GRCm39) missense probably damaging 1.00
R4898:Tbx15 UTSW 3 99,259,583 (GRCm39) missense possibly damaging 0.95
R4950:Tbx15 UTSW 3 99,233,700 (GRCm39) missense possibly damaging 0.82
R4982:Tbx15 UTSW 3 99,161,390 (GRCm39) missense probably benign 0.06
R4999:Tbx15 UTSW 3 99,223,649 (GRCm39) missense probably damaging 1.00
R5236:Tbx15 UTSW 3 99,259,362 (GRCm39) missense possibly damaging 0.92
R5339:Tbx15 UTSW 3 99,223,600 (GRCm39) missense possibly damaging 0.61
R5364:Tbx15 UTSW 3 99,259,508 (GRCm39) missense possibly damaging 0.90
R5493:Tbx15 UTSW 3 99,259,880 (GRCm39) missense probably benign
R5690:Tbx15 UTSW 3 99,216,166 (GRCm39) missense probably damaging 0.99
R6032:Tbx15 UTSW 3 99,259,833 (GRCm39) missense probably benign 0.28
R6032:Tbx15 UTSW 3 99,259,833 (GRCm39) missense probably benign 0.28
R6156:Tbx15 UTSW 3 99,220,431 (GRCm39) critical splice donor site probably null
R6173:Tbx15 UTSW 3 99,161,203 (GRCm39) nonsense probably null
R6596:Tbx15 UTSW 3 99,259,508 (GRCm39) missense probably benign
R6680:Tbx15 UTSW 3 99,220,389 (GRCm39) nonsense probably null
R6931:Tbx15 UTSW 3 99,259,467 (GRCm39) missense probably damaging 1.00
R8129:Tbx15 UTSW 3 99,161,254 (GRCm39) missense probably damaging 1.00
R8155:Tbx15 UTSW 3 99,259,886 (GRCm39) missense possibly damaging 0.69
R8230:Tbx15 UTSW 3 99,259,305 (GRCm39) missense probably damaging 1.00
R8729:Tbx15 UTSW 3 99,220,376 (GRCm39) missense possibly damaging 0.90
R8929:Tbx15 UTSW 3 99,222,219 (GRCm39) missense probably damaging 1.00
R9038:Tbx15 UTSW 3 99,222,085 (GRCm39) missense probably benign 0.14
R9688:Tbx15 UTSW 3 99,233,708 (GRCm39) missense possibly damaging 0.89
R9746:Tbx15 UTSW 3 99,259,647 (GRCm39) missense probably damaging 1.00
X0023:Tbx15 UTSW 3 99,222,151 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGGGTCTCCATCACAGTTTAC -3'
(R):5'- GAACATACTTACTAGGCTCTGGTTTTC -3'

Sequencing Primer
(F):5'- GGTCTCCATCACAGTTTACAGTGATC -3'
(R):5'- ACTAGGCTCTGGTTTTCTATTTTTAC -3'
Posted On 2016-11-21