Mutagenetix > Incidental Mutation

Incidental Mutation 'R5756:Tbx15'

445034

Institutional Source

Beutler Lab

Gene Symbol

Tbx15

Ensembl Gene

ENSMUSG00000027868

Gene Name

T-box 15

Synonyms

de, Tbx14, Tbx8

MMRRC Submission

043359-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.936) question?

Stock #

R5756 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

99240381-99354259 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 99313086 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 165 (I165F)

Ref Sequence

ENSEMBL: ENSMUSP00000029462 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029462] [ENSMUST00000150756] [ENSMUST00000151606]

AlphaFold

O70306

Predicted Effect

probably damaging
Transcript: ENSMUST00000029462
AA Change: I165F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000029462
Gene: ENSMUSG00000027868
AA Change: I165F

Domain	Start	End	E-Value	Type
low complexity region	2	17	N/A	INTRINSIC
TBOX	112	309	8.05e-131	SMART
Blast:TBOX	310	482	8e-83	BLAST
low complexity region	486	492	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000150756
AA Change: I59F

PolyPhen 2 Score 0.254 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000142358
Gene: ENSMUSG00000027868
AA Change: I59F

Domain	Start	End	E-Value	Type
TBOX	6	142	2.4e-72	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000151606

SMART Domains

Protein: ENSMUSP00000143417
Gene: ENSMUSG00000027868

Domain	Start	End	E-Value	Type
Pfam:T-box	8	51	1.1e-17	PFAM

Meta Mutation Damage Score

0.1342

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.5%

Validation Efficiency

100% (60/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the T-box family of genes, which encode a phylogenetically conserved family of transcription factors that regulate a variety of developmental processes. All these genes contain a common T-box DNA-binding domain. Mutations in this gene are associated with Cousin syndrome.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutants have low set ears that project laterally, skeletal abnormalities and distinctive dorsoventral coat color patterning. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930579C12Rik	A	G	9: 89,128,866		noncoding transcript	Het
9330182L06Rik	A	C	5: 9,462,995	K996N	probably damaging	Het
Aqp6	A	T	15: 99,602,742	I183F	probably damaging	Het
Asap1	A	T	15: 64,167,707	M218K	probably damaging	Het
Astn2	G	A	4: 66,119,188		probably benign	Het
Bmp5	A	G	9: 75,776,367	D92G	probably benign	Het
Cables1	A	G	18: 11,941,353	D511G	probably damaging	Het
Cacna1e	A	G	1: 154,471,637	M928T	probably benign	Het
Calcoco1	T	C	15: 102,719,651	N16S	probably benign	Het
Coro7	C	T	16: 4,632,284	R567Q	probably damaging	Het
Dgki	C	T	6: 36,937,058		probably benign	Het
Dusp11	T	C	6: 85,952,357	I147V	probably damaging	Het
Eif2ak4	T	C	2: 118,462,740	I1259T	possibly damaging	Het
Etfdh	T	C	3: 79,613,756	I219V	probably benign	Het
Ffar4	C	T	19: 38,113,958	T347I	probably damaging	Het
Fgf3	G	A	7: 144,842,951	S234N	probably benign	Het
Fnta	A	T	8: 26,009,707	I155N	possibly damaging	Het
Gcm2	G	A	13: 41,109,896	T20M	probably damaging	Het
Ggt5	A	T	10: 75,604,773	M243L	probably benign	Het
Ggta1	T	C	2: 35,402,383	Y304C	probably damaging	Het
Gm16432	A	T	1: 178,116,227	Q710L	unknown	Het
Gm5454	A	G	13: 103,356,347		noncoding transcript	Het
Gprc5c	G	T	11: 114,864,267	V257L	possibly damaging	Het
Hrc	T	C	7: 45,336,706	V427A	possibly damaging	Het
Ibtk	C	G	9: 85,731,254	V219L	possibly damaging	Het
Ift140	A	G	17: 25,028,813	H215R	possibly damaging	Het
Itln1	A	G	1: 171,516,917		probably benign	Het
Kif13b	T	C	14: 64,736,305	I368T	probably damaging	Het
Lars2	T	C	9: 123,438,199	Y529H	probably damaging	Het
Lrrc55	G	A	2: 85,196,383	T99I	probably benign	Het
Mycbp2	A	T	14: 103,133,974	I4156N	probably damaging	Het
Myo1c	T	G	11: 75,658,414	M137R	probably benign	Het
Olfr640	T	C	7: 104,021,682	D212G	probably damaging	Het
Olfr765	A	G	10: 129,046,226	V279A	probably benign	Het
Olfr921	T	A	9: 38,775,258	M1K	probably null	Het
Pde7a	A	G	3: 19,264,845	V12A	probably benign	Het
Phyhip	T	G	14: 70,467,092	C250W	probably damaging	Het
Pisd	G	A	5: 32,738,498	T412I	probably damaging	Het
Polr3c	T	C	3: 96,714,134	N444S	probably damaging	Het
Sart1	T	C	19: 5,380,469	E750G	probably damaging	Het
Sh3rf3	T	C	10: 59,104,382	V675A	probably damaging	Het
Slc4a11	G	T	2: 130,687,863	D307E	probably benign	Het
Slc6a16	A	T	7: 45,260,850	I315F	possibly damaging	Het
Smarca5	A	C	8: 80,710,604	S708A	probably benign	Het
Sv2c	T	C	13: 95,985,967	I434V	probably benign	Het
Tarsl2	A	G	7: 65,675,976	K433E	probably benign	Het
Tep1	C	T	14: 50,837,379		probably null	Het
Tex15	G	A	8: 33,575,833	G1764S	probably benign	Het
Tnfrsf19	A	G	14: 61,024,775	L13P	probably benign	Het
Tnnt3	G	A	7: 142,502,758		probably null	Het
Ttc23l	G	T	15: 10,551,550	T30K	possibly damaging	Het
Usp24	T	A	4: 106,362,483	I597K	probably damaging	Het
Usp40	C	T	1: 87,951,691	R960Q	possibly damaging	Het
Vps53	A	T	11: 76,092,330		probably benign	Het
Xylt1	C	T	7: 117,650,700	T699I	probably damaging	Het
Zfp81	A	C	17: 33,334,333	Y502*	probably null	Het
Zfyve26	T	A	12: 79,264,357	H145L	probably damaging	Het

Other mutations in Tbx15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01024:Tbx15	APN	3	99316246	missense	probably damaging	1.00
IGL01458:Tbx15	APN	3	99316228	missense	probably damaging	0.98
IGL01633:Tbx15	APN	3	99313042	missense	probably damaging	0.97
IGL02338:Tbx15	APN	3	99352484	missense	probably damaging	1.00
IGL02415:Tbx15	APN	3	99352510	missense	probably benign	0.01
IGL03143:Tbx15	APN	3	99352198	missense	possibly damaging	0.67
IGL03201:Tbx15	APN	3	99351980	missense	probably benign	0.00
shin_guard	UTSW	3	99352192	missense	possibly damaging	0.90
Shortcut	UTSW	3	99313073	nonsense	probably null
R0012:Tbx15	UTSW	3	99352096	missense	probably benign
R0109:Tbx15	UTSW	3	99351866	missense	possibly damaging	0.92
R0277:Tbx15	UTSW	3	99352391	missense	probably damaging	1.00
R0462:Tbx15	UTSW	3	99316318	missense	probably damaging	1.00
R1134:Tbx15	UTSW	3	99316323	missense	probably damaging	0.98
R1347:Tbx15	UTSW	3	99352111	missense	possibly damaging	0.92
R1347:Tbx15	UTSW	3	99352111	missense	possibly damaging	0.92
R1506:Tbx15	UTSW	3	99351912	missense	possibly damaging	0.80
R1681:Tbx15	UTSW	3	99351824	splice site	probably null
R1762:Tbx15	UTSW	3	99351944	nonsense	probably null
R1789:Tbx15	UTSW	3	99352246	nonsense	probably null
R2167:Tbx15	UTSW	3	99326455	splice site	probably benign
R2254:Tbx15	UTSW	3	99351874	missense	possibly damaging	0.52
R2357:Tbx15	UTSW	3	99316356	splice site	probably null
R2441:Tbx15	UTSW	3	99352511	missense	probably damaging	0.99
R3010:Tbx15	UTSW	3	99253893	intron	probably benign
R3118:Tbx15	UTSW	3	99352154	missense	probably damaging	0.96
R4081:Tbx15	UTSW	3	99313054	missense	possibly damaging	0.92
R4610:Tbx15	UTSW	3	99352367	missense	probably damaging	1.00
R4898:Tbx15	UTSW	3	99352267	missense	possibly damaging	0.95
R4950:Tbx15	UTSW	3	99326384	missense	possibly damaging	0.82
R4982:Tbx15	UTSW	3	99254074	missense	probably benign	0.06
R4999:Tbx15	UTSW	3	99316333	missense	probably damaging	1.00
R5236:Tbx15	UTSW	3	99352046	missense	possibly damaging	0.92
R5339:Tbx15	UTSW	3	99316284	missense	possibly damaging	0.61
R5364:Tbx15	UTSW	3	99352192	missense	possibly damaging	0.90
R5493:Tbx15	UTSW	3	99352564	missense	probably benign
R5690:Tbx15	UTSW	3	99308850	missense	probably damaging	0.99
R6032:Tbx15	UTSW	3	99352517	missense	probably benign	0.28
R6032:Tbx15	UTSW	3	99352517	missense	probably benign	0.28
R6156:Tbx15	UTSW	3	99313115	critical splice donor site	probably null
R6173:Tbx15	UTSW	3	99253887	nonsense	probably null
R6596:Tbx15	UTSW	3	99352192	missense	probably benign
R6680:Tbx15	UTSW	3	99313073	nonsense	probably null
R6931:Tbx15	UTSW	3	99352151	missense	probably damaging	1.00
R8129:Tbx15	UTSW	3	99253938	missense	probably damaging	1.00
R8155:Tbx15	UTSW	3	99352570	missense	possibly damaging	0.69
R8230:Tbx15	UTSW	3	99351989	missense	probably damaging	1.00
R8729:Tbx15	UTSW	3	99313060	missense	possibly damaging	0.90
R8929:Tbx15	UTSW	3	99314903	missense	probably damaging	1.00
R9038:Tbx15	UTSW	3	99314769	missense	probably benign	0.14
R9688:Tbx15	UTSW	3	99326392	missense	possibly damaging	0.89
R9746:Tbx15	UTSW	3	99352331	missense	probably damaging	1.00
X0023:Tbx15	UTSW	3	99314835	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCGGGTCTCCATCACAGTTTAC -3'
(R):5'- GAACATACTTACTAGGCTCTGGTTTTC -3'

Sequencing Primer
(F):5'- GGTCTCCATCACAGTTTACAGTGATC -3'
(R):5'- ACTAGGCTCTGGTTTTCTATTTTTAC -3'

Posted On

2016-11-21