Incidental Mutation 'R5756:Fgf3'
ID445046
Institutional Source Beutler Lab
Gene Symbol Fgf3
Ensembl Gene ENSMUSG00000031074
Gene Namefibroblast growth factor 3
SynonymsInt-P, Int-2, Fgf-3
MMRRC Submission 043359-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5756 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location144838083-144844436 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 144842951 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 234 (S234N)
Ref Sequence ENSEMBL: ENSMUSP00000101518 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105898] [ENSMUST00000155320] [ENSMUST00000208265]
Predicted Effect probably benign
Transcript: ENSMUST00000105898
AA Change: S234N

PolyPhen 2 Score 0.439 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000101518
Gene: ENSMUSG00000031074
AA Change: S234N

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
FGF 42 182 1.13e-66 SMART
low complexity region 206 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155320
SMART Domains Protein: ENSMUSP00000115205
Gene: ENSMUSG00000031074

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
FGF 42 154 3.75e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000208265
Meta Mutation Damage Score 0.1176 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities and are involved in a variety of biological processes including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This gene was identified by its similarity with mouse fgf3/int-2, a proto-oncogene activated in virally induced mammary tumors in the mouse. Frequent amplification of this gene has been found in human tumors, which may be important for neoplastic transformation and tumor progression. Studies of the similar genes in mouse and chicken suggested the role in inner ear formation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions of this gene have short, thickened and curved tails. Otic vesicles are somewhat smaller than normal. Mice with some alleles apparently display more severe phenotypes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579C12Rik A G 9: 89,128,866 noncoding transcript Het
9330182L06Rik A C 5: 9,462,995 K996N probably damaging Het
Aqp6 A T 15: 99,602,742 I183F probably damaging Het
Asap1 A T 15: 64,167,707 M218K probably damaging Het
Astn2 G A 4: 66,119,188 probably benign Het
Bmp5 A G 9: 75,776,367 D92G probably benign Het
Cables1 A G 18: 11,941,353 D511G probably damaging Het
Cacna1e A G 1: 154,471,637 M928T probably benign Het
Calcoco1 T C 15: 102,719,651 N16S probably benign Het
Coro7 C T 16: 4,632,284 R567Q probably damaging Het
Dgki C T 6: 36,937,058 probably benign Het
Dusp11 T C 6: 85,952,357 I147V probably damaging Het
Eif2ak4 T C 2: 118,462,740 I1259T possibly damaging Het
Etfdh T C 3: 79,613,756 I219V probably benign Het
Ffar4 C T 19: 38,113,958 T347I probably damaging Het
Fnta A T 8: 26,009,707 I155N possibly damaging Het
Gcm2 G A 13: 41,109,896 T20M probably damaging Het
Ggt5 A T 10: 75,604,773 M243L probably benign Het
Ggta1 T C 2: 35,402,383 Y304C probably damaging Het
Gm16432 A T 1: 178,116,227 Q710L unknown Het
Gm5454 A G 13: 103,356,347 noncoding transcript Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hrc T C 7: 45,336,706 V427A possibly damaging Het
Ibtk C G 9: 85,731,254 V219L possibly damaging Het
Ift140 A G 17: 25,028,813 H215R possibly damaging Het
Itln1 A G 1: 171,516,917 probably benign Het
Kif13b T C 14: 64,736,305 I368T probably damaging Het
Lars2 T C 9: 123,438,199 Y529H probably damaging Het
Lrrc55 G A 2: 85,196,383 T99I probably benign Het
Mycbp2 A T 14: 103,133,974 I4156N probably damaging Het
Myo1c T G 11: 75,658,414 M137R probably benign Het
Olfr640 T C 7: 104,021,682 D212G probably damaging Het
Olfr765 A G 10: 129,046,226 V279A probably benign Het
Olfr921 T A 9: 38,775,258 M1K probably null Het
Pde7a A G 3: 19,264,845 V12A probably benign Het
Phyhip T G 14: 70,467,092 C250W probably damaging Het
Pisd G A 5: 32,738,498 T412I probably damaging Het
Polr3c T C 3: 96,714,134 N444S probably damaging Het
Sart1 T C 19: 5,380,469 E750G probably damaging Het
Sh3rf3 T C 10: 59,104,382 V675A probably damaging Het
Slc4a11 G T 2: 130,687,863 D307E probably benign Het
Slc6a16 A T 7: 45,260,850 I315F possibly damaging Het
Smarca5 A C 8: 80,710,604 S708A probably benign Het
Sv2c T C 13: 95,985,967 I434V probably benign Het
Tarsl2 A G 7: 65,675,976 K433E probably benign Het
Tbx15 A T 3: 99,313,086 I165F probably damaging Het
Tep1 C T 14: 50,837,379 probably null Het
Tex15 G A 8: 33,575,833 G1764S probably benign Het
Tnfrsf19 A G 14: 61,024,775 L13P probably benign Het
Tnnt3 G A 7: 142,502,758 probably null Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Usp24 T A 4: 106,362,483 I597K probably damaging Het
Usp40 C T 1: 87,951,691 R960Q possibly damaging Het
Vps53 A T 11: 76,092,330 probably benign Het
Xylt1 C T 7: 117,650,700 T699I probably damaging Het
Zfp81 A C 17: 33,334,333 Y502* probably null Het
Zfyve26 T A 12: 79,264,357 H145L probably damaging Het
Other mutations in Fgf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Fgf3 APN 7 144840784 splice site probably benign
IGL02679:Fgf3 APN 7 144840750 missense probably damaging 1.00
Porkchop UTSW 7 144840707 missense probably damaging 1.00
R0471:Fgf3 UTSW 7 144842810 missense probably damaging 1.00
R1351:Fgf3 UTSW 7 144840780 splice site probably benign
R4428:Fgf3 UTSW 7 144840707 missense probably damaging 1.00
R5184:Fgf3 UTSW 7 144842810 missense probably damaging 1.00
R5677:Fgf3 UTSW 7 144838783 nonsense probably null
R7267:Fgf3 UTSW 7 144838832 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGTGTCGGTGAATGGCAAG -3'
(R):5'- GCACTTGCTCTTTGAAAGCTG -3'

Sequencing Primer
(F):5'- ACGCAGGGGCTTCAAGAC -3'
(R):5'- GTAAAAGGCATGCAAGTTCTTGGTC -3'
Posted On2016-11-21