Incidental Mutation 'R5756:Smarca5'
ID445049
Institutional Source Beutler Lab
Gene Symbol Smarca5
Ensembl Gene ENSMUSG00000031715
Gene NameSWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5
SynonymsD030040M08Rik, D330027N15Rik, 4933427E24Rik, MommeD4, Snf2h
MMRRC Submission 043359-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5756 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location80698507-80739497 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 80710604 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 708 (S708A)
Ref Sequence ENSEMBL: ENSMUSP00000044361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043359]
Predicted Effect probably benign
Transcript: ENSMUST00000043359
AA Change: S708A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000044361
Gene: ENSMUSG00000031715
AA Change: S708A

DomainStartEndE-ValueType
low complexity region 2 53 N/A INTRINSIC
Pfam:DBINO 65 112 1.1e-4 PFAM
low complexity region 145 156 N/A INTRINSIC
DEXDc 175 367 3.9e-46 SMART
Blast:DEXDc 386 421 6e-11 BLAST
HELICc 512 596 6.2e-28 SMART
low complexity region 756 768 N/A INTRINSIC
low complexity region 820 837 N/A INTRINSIC
SANT 840 889 2.3e-7 SMART
SANT 942 1006 3e-7 SMART
low complexity region 1008 1024 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122807
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142470
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150277
Meta Mutation Damage Score 0.0580 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The protein encoded by this gene is a component of the chromatin remodeling and spacing factor RSF, a facilitator of the transcription of class II genes by RNA polymerase II. The encoded protein is similar in sequence to the Drosophila ISWI chromatin remodeling protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice die during early embryonic development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579C12Rik A G 9: 89,128,866 noncoding transcript Het
9330182L06Rik A C 5: 9,462,995 K996N probably damaging Het
Aqp6 A T 15: 99,602,742 I183F probably damaging Het
Asap1 A T 15: 64,167,707 M218K probably damaging Het
Astn2 G A 4: 66,119,188 probably benign Het
Bmp5 A G 9: 75,776,367 D92G probably benign Het
Cables1 A G 18: 11,941,353 D511G probably damaging Het
Cacna1e A G 1: 154,471,637 M928T probably benign Het
Calcoco1 T C 15: 102,719,651 N16S probably benign Het
Coro7 C T 16: 4,632,284 R567Q probably damaging Het
Dgki C T 6: 36,937,058 probably benign Het
Dusp11 T C 6: 85,952,357 I147V probably damaging Het
Eif2ak4 T C 2: 118,462,740 I1259T possibly damaging Het
Etfdh T C 3: 79,613,756 I219V probably benign Het
Ffar4 C T 19: 38,113,958 T347I probably damaging Het
Fgf3 G A 7: 144,842,951 S234N probably benign Het
Fnta A T 8: 26,009,707 I155N possibly damaging Het
Gcm2 G A 13: 41,109,896 T20M probably damaging Het
Ggt5 A T 10: 75,604,773 M243L probably benign Het
Ggta1 T C 2: 35,402,383 Y304C probably damaging Het
Gm16432 A T 1: 178,116,227 Q710L unknown Het
Gm5454 A G 13: 103,356,347 noncoding transcript Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hrc T C 7: 45,336,706 V427A possibly damaging Het
Ibtk C G 9: 85,731,254 V219L possibly damaging Het
Ift140 A G 17: 25,028,813 H215R possibly damaging Het
Itln1 A G 1: 171,516,917 probably benign Het
Kif13b T C 14: 64,736,305 I368T probably damaging Het
Lars2 T C 9: 123,438,199 Y529H probably damaging Het
Lrrc55 G A 2: 85,196,383 T99I probably benign Het
Mycbp2 A T 14: 103,133,974 I4156N probably damaging Het
Myo1c T G 11: 75,658,414 M137R probably benign Het
Olfr640 T C 7: 104,021,682 D212G probably damaging Het
Olfr765 A G 10: 129,046,226 V279A probably benign Het
Olfr921 T A 9: 38,775,258 M1K probably null Het
Pde7a A G 3: 19,264,845 V12A probably benign Het
Phyhip T G 14: 70,467,092 C250W probably damaging Het
Pisd G A 5: 32,738,498 T412I probably damaging Het
Polr3c T C 3: 96,714,134 N444S probably damaging Het
Sart1 T C 19: 5,380,469 E750G probably damaging Het
Sh3rf3 T C 10: 59,104,382 V675A probably damaging Het
Slc4a11 G T 2: 130,687,863 D307E probably benign Het
Slc6a16 A T 7: 45,260,850 I315F possibly damaging Het
Sv2c T C 13: 95,985,967 I434V probably benign Het
Tarsl2 A G 7: 65,675,976 K433E probably benign Het
Tbx15 A T 3: 99,313,086 I165F probably damaging Het
Tep1 C T 14: 50,837,379 probably null Het
Tex15 G A 8: 33,575,833 G1764S probably benign Het
Tnfrsf19 A G 14: 61,024,775 L13P probably benign Het
Tnnt3 G A 7: 142,502,758 probably null Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Usp24 T A 4: 106,362,483 I597K probably damaging Het
Usp40 C T 1: 87,951,691 R960Q possibly damaging Het
Vps53 A T 11: 76,092,330 probably benign Het
Xylt1 C T 7: 117,650,700 T699I probably damaging Het
Zfp81 A C 17: 33,334,333 Y502* probably null Het
Zfyve26 T A 12: 79,264,357 H145L probably damaging Het
Other mutations in Smarca5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Smarca5 APN 8 80714041 missense probably benign 0.10
IGL01138:Smarca5 APN 8 80701076 missense possibly damaging 0.87
IGL01290:Smarca5 APN 8 80727648 missense probably benign
IGL02338:Smarca5 APN 8 80719570 splice site probably benign
IGL03212:Smarca5 APN 8 80711781 missense possibly damaging 0.47
IGL03216:Smarca5 APN 8 80719658 missense probably damaging 1.00
Cipher UTSW 8 80719652 missense probably damaging 1.00
Codebook UTSW 8 80733707 missense probably benign
Codex UTSW 8 80710563 missense probably damaging 0.99
R0254:Smarca5 UTSW 8 80704700 missense probably benign 0.05
R0374:Smarca5 UTSW 8 80736731 missense probably benign 0.30
R0625:Smarca5 UTSW 8 80720686 critical splice donor site probably null
R1065:Smarca5 UTSW 8 80704714 missense probably damaging 1.00
R1164:Smarca5 UTSW 8 80710631 missense probably damaging 1.00
R1709:Smarca5 UTSW 8 80709220 nonsense probably null
R2102:Smarca5 UTSW 8 80704675 missense probably damaging 1.00
R3831:Smarca5 UTSW 8 80728494 missense probably damaging 0.99
R4625:Smarca5 UTSW 8 80710563 missense probably damaging 0.99
R4750:Smarca5 UTSW 8 80733707 missense probably benign
R4822:Smarca5 UTSW 8 80708680 splice site probably null
R4889:Smarca5 UTSW 8 80704697 missense possibly damaging 0.95
R6120:Smarca5 UTSW 8 80711743 missense probably damaging 0.98
R6582:Smarca5 UTSW 8 80719652 missense probably damaging 1.00
R6939:Smarca5 UTSW 8 80705320 missense possibly damaging 0.63
R6972:Smarca5 UTSW 8 80704751 missense probably damaging 1.00
R6973:Smarca5 UTSW 8 80704751 missense probably damaging 1.00
R7027:Smarca5 UTSW 8 80736726 missense probably benign 0.07
R7376:Smarca5 UTSW 8 80726051 missense probably damaging 1.00
R7514:Smarca5 UTSW 8 80717534 missense probably damaging 1.00
R7962:Smarca5 UTSW 8 80736759 missense probably benign
R8031:Smarca5 UTSW 8 80704682 missense probably damaging 1.00
R8400:Smarca5 UTSW 8 80709127 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CCACCCAGGGCCATATTAAG -3'
(R):5'- GCTTTGATCTAGCTGCCAAGG -3'

Sequencing Primer
(F):5'- ACCCAGGGCCATATTAAGATATC -3'
(R):5'- GAACGAAAAGCTCTCCAAGA -3'
Posted On2016-11-21