Mutagenetix > Incidental Mutation

Incidental Mutation 'R5756:Smarca5'

445049

Institutional Source

Beutler Lab

Gene Symbol

Smarca5

Ensembl Gene

ENSMUSG00000031715

Gene Name

SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5

Synonyms

D030040M08Rik, D330027N15Rik, 4933427E24Rik, MommeD4, Snf2h

MMRRC Submission

043359-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5756 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

80698507-80739497 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 80710604 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Alanine at position 708 (S708A)

Ref Sequence

ENSEMBL: ENSMUSP00000044361 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043359]

AlphaFold

Q91ZW3

Predicted Effect

probably benign
Transcript: ENSMUST00000043359
AA Change: S708A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000044361
Gene: ENSMUSG00000031715
AA Change: S708A

Domain	Start	End	E-Value	Type
low complexity region	2	53	N/A	INTRINSIC
Pfam:DBINO	65	112	1.1e-4	PFAM
low complexity region	145	156	N/A	INTRINSIC
DEXDc	175	367	3.9e-46	SMART
Blast:DEXDc	386	421	6e-11	BLAST
HELICc	512	596	6.2e-28	SMART
low complexity region	756	768	N/A	INTRINSIC
low complexity region	820	837	N/A	INTRINSIC
SANT	840	889	2.3e-7	SMART
SANT	942	1006	3e-7	SMART
low complexity region	1008	1024	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122807

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142470

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150277

Meta Mutation Damage Score

0.0580

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.5%

Validation Efficiency

100% (60/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The protein encoded by this gene is a component of the chromatin remodeling and spacing factor RSF, a facilitator of the transcription of class II genes by RNA polymerase II. The encoded protein is similar in sequence to the Drosophila ISWI chromatin remodeling protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice die during early embryonic development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930579C12Rik	A	G	9: 89,128,866		noncoding transcript	Het
9330182L06Rik	A	C	5: 9,462,995	K996N	probably damaging	Het
Aqp6	A	T	15: 99,602,742	I183F	probably damaging	Het
Asap1	A	T	15: 64,167,707	M218K	probably damaging	Het
Astn2	G	A	4: 66,119,188		probably benign	Het
Bmp5	A	G	9: 75,776,367	D92G	probably benign	Het
Cables1	A	G	18: 11,941,353	D511G	probably damaging	Het
Cacna1e	A	G	1: 154,471,637	M928T	probably benign	Het
Calcoco1	T	C	15: 102,719,651	N16S	probably benign	Het
Coro7	C	T	16: 4,632,284	R567Q	probably damaging	Het
Dgki	C	T	6: 36,937,058		probably benign	Het
Dusp11	T	C	6: 85,952,357	I147V	probably damaging	Het
Eif2ak4	T	C	2: 118,462,740	I1259T	possibly damaging	Het
Etfdh	T	C	3: 79,613,756	I219V	probably benign	Het
Ffar4	C	T	19: 38,113,958	T347I	probably damaging	Het
Fgf3	G	A	7: 144,842,951	S234N	probably benign	Het
Fnta	A	T	8: 26,009,707	I155N	possibly damaging	Het
Gcm2	G	A	13: 41,109,896	T20M	probably damaging	Het
Ggt5	A	T	10: 75,604,773	M243L	probably benign	Het
Ggta1	T	C	2: 35,402,383	Y304C	probably damaging	Het
Gm16432	A	T	1: 178,116,227	Q710L	unknown	Het
Gm5454	A	G	13: 103,356,347		noncoding transcript	Het
Gprc5c	G	T	11: 114,864,267	V257L	possibly damaging	Het
Hrc	T	C	7: 45,336,706	V427A	possibly damaging	Het
Ibtk	C	G	9: 85,731,254	V219L	possibly damaging	Het
Ift140	A	G	17: 25,028,813	H215R	possibly damaging	Het
Itln1	A	G	1: 171,516,917		probably benign	Het
Kif13b	T	C	14: 64,736,305	I368T	probably damaging	Het
Lars2	T	C	9: 123,438,199	Y529H	probably damaging	Het
Lrrc55	G	A	2: 85,196,383	T99I	probably benign	Het
Mycbp2	A	T	14: 103,133,974	I4156N	probably damaging	Het
Myo1c	T	G	11: 75,658,414	M137R	probably benign	Het
Olfr640	T	C	7: 104,021,682	D212G	probably damaging	Het
Olfr765	A	G	10: 129,046,226	V279A	probably benign	Het
Olfr921	T	A	9: 38,775,258	M1K	probably null	Het
Pde7a	A	G	3: 19,264,845	V12A	probably benign	Het
Phyhip	T	G	14: 70,467,092	C250W	probably damaging	Het
Pisd	G	A	5: 32,738,498	T412I	probably damaging	Het
Polr3c	T	C	3: 96,714,134	N444S	probably damaging	Het
Sart1	T	C	19: 5,380,469	E750G	probably damaging	Het
Sh3rf3	T	C	10: 59,104,382	V675A	probably damaging	Het
Slc4a11	G	T	2: 130,687,863	D307E	probably benign	Het
Slc6a16	A	T	7: 45,260,850	I315F	possibly damaging	Het
Sv2c	T	C	13: 95,985,967	I434V	probably benign	Het
Tarsl2	A	G	7: 65,675,976	K433E	probably benign	Het
Tbx15	A	T	3: 99,313,086	I165F	probably damaging	Het
Tep1	C	T	14: 50,837,379		probably null	Het
Tex15	G	A	8: 33,575,833	G1764S	probably benign	Het
Tnfrsf19	A	G	14: 61,024,775	L13P	probably benign	Het
Tnnt3	G	A	7: 142,502,758		probably null	Het
Ttc23l	G	T	15: 10,551,550	T30K	possibly damaging	Het
Usp24	T	A	4: 106,362,483	I597K	probably damaging	Het
Usp40	C	T	1: 87,951,691	R960Q	possibly damaging	Het
Vps53	A	T	11: 76,092,330		probably benign	Het
Xylt1	C	T	7: 117,650,700	T699I	probably damaging	Het
Zfp81	A	C	17: 33,334,333	Y502*	probably null	Het
Zfyve26	T	A	12: 79,264,357	H145L	probably damaging	Het

Other mutations in Smarca5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00323:Smarca5	APN	8	80714041	missense	probably benign	0.10
IGL01138:Smarca5	APN	8	80701076	missense	possibly damaging	0.87
IGL01290:Smarca5	APN	8	80727648	missense	probably benign
IGL02338:Smarca5	APN	8	80719570	splice site	probably benign
IGL03212:Smarca5	APN	8	80711781	missense	possibly damaging	0.47
IGL03216:Smarca5	APN	8	80719658	missense	probably damaging	1.00
Cipher	UTSW	8	80719652	missense	probably damaging	1.00
Codebook	UTSW	8	80733707	missense	probably benign
Codex	UTSW	8	80710563	missense	probably damaging	0.99
Encryption	UTSW	8	80704726	missense	probably damaging	1.00
Enigma	UTSW	8	80705332	missense	probably benign	0.35
Key	UTSW	8	80726051	missense	probably damaging	1.00
Sailor	UTSW	8	80736726	missense	probably benign	0.07
Soldier	UTSW	8	80719715	missense	probably damaging	1.00
tinker	UTSW	8	80733750	missense	probably benign
R0254:Smarca5	UTSW	8	80704700	missense	probably benign	0.05
R0374:Smarca5	UTSW	8	80736731	missense	probably benign	0.30
R0625:Smarca5	UTSW	8	80720686	critical splice donor site	probably null
R1065:Smarca5	UTSW	8	80704714	missense	probably damaging	1.00
R1164:Smarca5	UTSW	8	80710631	missense	probably damaging	1.00
R1709:Smarca5	UTSW	8	80709220	nonsense	probably null
R2102:Smarca5	UTSW	8	80704675	missense	probably damaging	1.00
R3831:Smarca5	UTSW	8	80728494	missense	probably damaging	0.99
R4625:Smarca5	UTSW	8	80710563	missense	probably damaging	0.99
R4750:Smarca5	UTSW	8	80733707	missense	probably benign
R4822:Smarca5	UTSW	8	80708680	splice site	probably null
R4889:Smarca5	UTSW	8	80704697	missense	possibly damaging	0.95
R6120:Smarca5	UTSW	8	80711743	missense	probably damaging	0.98
R6582:Smarca5	UTSW	8	80719652	missense	probably damaging	1.00
R6939:Smarca5	UTSW	8	80705320	missense	possibly damaging	0.63
R6972:Smarca5	UTSW	8	80704751	missense	probably damaging	1.00
R6973:Smarca5	UTSW	8	80704751	missense	probably damaging	1.00
R7027:Smarca5	UTSW	8	80736726	missense	probably benign	0.07
R7376:Smarca5	UTSW	8	80726051	missense	probably damaging	1.00
R7514:Smarca5	UTSW	8	80717534	missense	probably damaging	1.00
R7962:Smarca5	UTSW	8	80736759	missense	probably benign
R8031:Smarca5	UTSW	8	80704682	missense	probably damaging	1.00
R8400:Smarca5	UTSW	8	80709127	missense	probably benign	0.02
R8798:Smarca5	UTSW	8	80716508	missense	probably damaging	1.00
R8817:Smarca5	UTSW	8	80733750	missense	probably benign
R8824:Smarca5	UTSW	8	80705332	missense	probably benign	0.35
R8905:Smarca5	UTSW	8	80713948	missense	probably benign	0.14
R9018:Smarca5	UTSW	8	80704726	missense	probably damaging	1.00
R9028:Smarca5	UTSW	8	80714013	missense	probably damaging	1.00
R9203:Smarca5	UTSW	8	80704629	nonsense	probably null
R9253:Smarca5	UTSW	8	80719715	missense	probably damaging	1.00
R9294:Smarca5	UTSW	8	80719803	missense	probably damaging	1.00
R9328:Smarca5	UTSW	8	80720749	missense	probably benign	0.00
R9396:Smarca5	UTSW	8	80736729	missense	probably benign	0.00
R9514:Smarca5	UTSW	8	80702211	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCACCCAGGGCCATATTAAG -3'
(R):5'- GCTTTGATCTAGCTGCCAAGG -3'

Sequencing Primer
(F):5'- ACCCAGGGCCATATTAAGATATC -3'
(R):5'- GAACGAAAAGCTCTCCAAGA -3'

Posted On

2016-11-21