Incidental Mutation 'R0027:Snrnp40'
ID 44505
Institutional Source Beutler Lab
Gene Symbol Snrnp40
Ensembl Gene ENSMUSG00000074088
Gene Name small nuclear ribonucleoprotein 40 (U5)
Synonyms 0610009C03Rik, Wdr57
MMRRC Submission 038322-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R0027 (G1) of strain 730
Quality Score 225
Status Validated (trace)
Chromosome 4
Chromosomal Location 130360132-130390026 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 130368273 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 151 (H151Q)
Ref Sequence ENSEMBL: ENSMUSP00000101616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105994]
AlphaFold Q6PE01
Predicted Effect probably damaging
Transcript: ENSMUST00000105994
AA Change: H151Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101616
Gene: ENSMUSG00000074088
AA Change: H151Q

DomainStartEndE-ValueType
low complexity region 24 45 N/A INTRINSIC
WD40 56 95 1.64e-9 SMART
WD40 99 138 1.83e-7 SMART
WD40 141 181 8.68e-9 SMART
WD40 184 222 3.81e-5 SMART
WD40 225 264 3.24e-8 SMART
WD40 271 314 5.1e-6 SMART
WD40 317 356 2.84e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180577
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181161
Meta Mutation Damage Score 0.9467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the U5 small nuclear ribonucleoprotein (snRNP) particle. The U5 snRNP is part of the spliceosome, a multiprotein complex that catalyzes the removal of introns from pre-messenger RNAs. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts12 A T 15: 11,285,873 I723F probably damaging Het
Anapc1 G T 2: 128,641,511 D1221E possibly damaging Het
Arhgef28 T A 13: 97,945,696 E1201V possibly damaging Het
Capn12 T A 7: 28,881,960 H79Q probably benign Het
Caprin1 A T 2: 103,775,580 probably benign Het
Carmil3 T A 14: 55,494,403 F196Y probably damaging Het
Casp8ap2 A G 4: 32,643,810 H961R probably benign Het
Cdkl3 C T 11: 52,032,349 probably benign Het
Cic T A 7: 25,287,140 S1299T probably damaging Het
Cic C A 7: 25,287,141 S1299Y probably damaging Het
Col13a1 A G 10: 61,850,161 L684P unknown Het
D10Wsu102e G A 10: 83,364,529 probably benign Het
D430041D05Rik A T 2: 104,255,044 F1053L probably benign Het
Dab1 T C 4: 104,704,199 probably benign Het
Dmxl1 A T 18: 49,957,295 probably benign Het
Dst C T 1: 34,189,119 P1606L probably damaging Het
E130309D02Rik G A 5: 143,308,062 T220I probably damaging Het
Eml1 T C 12: 108,536,298 C708R possibly damaging Het
Fam131b T A 6: 42,318,248 M304L probably benign Het
Foxk1 A T 5: 142,450,340 I321F probably damaging Het
Gm10306 C T 4: 94,556,790 probably benign Het
Gm10985 TA TANA 3: 53,845,256 probably null Het
Gse1 T C 8: 120,566,546 probably benign Het
Hcn3 A G 3: 89,159,825 S79P probably damaging Het
Hspa4 T A 11: 53,283,585 M203L probably benign Het
Kctd7 G A 5: 130,152,573 R279H probably damaging Het
Kif11 C T 19: 37,406,983 probably benign Het
Klf13 T C 7: 63,891,761 N206S probably benign Het
Kpna7 A T 5: 144,989,697 Y482N probably damaging Het
Lamc1 T C 1: 153,262,583 Y175C probably damaging Het
Lrpprc G A 17: 84,767,007 R491* probably null Het
Madd T A 2: 91,152,549 I1350F probably damaging Het
Mbtd1 T C 11: 93,924,549 V321A possibly damaging Het
Mon2 G A 10: 123,036,048 S357L possibly damaging Het
Ndst3 A G 3: 123,671,513 V270A probably damaging Het
Nlrp2 T C 7: 5,322,448 T742A probably damaging Het
Olfr214 T C 6: 116,556,949 S175P probably damaging Het
Papola A C 12: 105,833,136 S675R probably benign Het
Pcdh9 T A 14: 93,888,645 I30F probably null Het
Prl6a1 T A 13: 27,318,028 L126Q probably damaging Het
Prr29 A G 11: 106,376,276 E89G possibly damaging Het
Psmd1 T C 1: 86,094,265 probably benign Het
Rad9b A G 5: 122,351,723 probably benign Het
Rest T C 5: 77,282,551 V939A probably benign Het
Rnf135 T A 11: 80,193,942 S180R probably benign Het
Sarm1 C A 11: 78,488,091 R376L probably damaging Het
Scap C A 9: 110,379,730 P613Q probably benign Het
Scube3 C T 17: 28,164,357 R374* probably null Het
Setx T G 2: 29,139,221 V167G probably damaging Het
Sox21 G T 14: 118,235,617 H7N probably benign Het
Stard9 A T 2: 120,703,501 Q3413L probably benign Het
Sycp1 A G 3: 102,895,910 V528A probably benign Het
Tcl1b3 A T 12: 105,191,239 S47C probably damaging Het
Treml4 T C 17: 48,264,934 S122P possibly damaging Het
Trip11 C T 12: 101,885,169 A879T probably benign Het
Ubr4 C A 4: 139,400,393 N567K probably damaging Het
Zan T C 5: 137,406,519 probably benign Het
Zfp804a G A 2: 82,257,200 D458N probably damaging Het
Zic2 T C 14: 122,476,343 M223T possibly damaging Het
Other mutations in Snrnp40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02200:Snrnp40 APN 4 130360221 missense probably damaging 0.99
IGL02306:Snrnp40 APN 4 130365100 missense probably benign 0.21
skywarp UTSW 4 130378043 splice site probably null
R0027:Snrnp40 UTSW 4 130368273 missense probably damaging 1.00
R0077:Snrnp40 UTSW 4 130378043 splice site probably null
R0134:Snrnp40 UTSW 4 130378043 splice site probably null
R0211:Snrnp40 UTSW 4 130378043 splice site probably null
R0349:Snrnp40 UTSW 4 130378043 splice site probably null
R0371:Snrnp40 UTSW 4 130378043 splice site probably null
R0372:Snrnp40 UTSW 4 130378043 splice site probably null
R0376:Snrnp40 UTSW 4 130378043 splice site probably null
R0377:Snrnp40 UTSW 4 130378043 splice site probably null
R0400:Snrnp40 UTSW 4 130362650 missense probably damaging 1.00
R0442:Snrnp40 UTSW 4 130378043 splice site probably null
R0443:Snrnp40 UTSW 4 130378043 splice site probably null
R0486:Snrnp40 UTSW 4 130378043 splice site probably null
R0488:Snrnp40 UTSW 4 130378043 splice site probably null
R0568:Snrnp40 UTSW 4 130378043 splice site probably null
R0624:Snrnp40 UTSW 4 130362658 missense probably damaging 0.98
R0632:Snrnp40 UTSW 4 130378043 splice site probably null
R0650:Snrnp40 UTSW 4 130378043 splice site probably null
R0733:Snrnp40 UTSW 4 130378043 splice site probably null
R1161:Snrnp40 UTSW 4 130378043 splice site probably null
R1182:Snrnp40 UTSW 4 130378043 splice site probably null
R1234:Snrnp40 UTSW 4 130378043 splice site probably null
R1236:Snrnp40 UTSW 4 130378043 splice site probably null
R1305:Snrnp40 UTSW 4 130378043 splice site probably null
R1308:Snrnp40 UTSW 4 130378043 splice site probably null
R1333:Snrnp40 UTSW 4 130378043 splice site probably null
R1413:Snrnp40 UTSW 4 130378043 splice site probably null
R1569:Snrnp40 UTSW 4 130378043 splice site probably null
R1616:Snrnp40 UTSW 4 130378043 splice site probably null
R1656:Snrnp40 UTSW 4 130378043 splice site probably null
R1675:Snrnp40 UTSW 4 130378043 splice site probably null
R1759:Snrnp40 UTSW 4 130378043 splice site probably null
R1856:Snrnp40 UTSW 4 130378043 splice site probably null
R1901:Snrnp40 UTSW 4 130385975 missense probably damaging 0.98
R1912:Snrnp40 UTSW 4 130378043 splice site probably null
R1930:Snrnp40 UTSW 4 130378043 splice site probably null
R1931:Snrnp40 UTSW 4 130378043 splice site probably null
R2435:Snrnp40 UTSW 4 130384551 missense probably damaging 1.00
R3722:Snrnp40 UTSW 4 130368275 missense possibly damaging 0.76
R4782:Snrnp40 UTSW 4 130362756 missense probably damaging 1.00
R4799:Snrnp40 UTSW 4 130362756 missense probably damaging 1.00
R5075:Snrnp40 UTSW 4 130388582 missense probably benign 0.07
R5104:Snrnp40 UTSW 4 130365165 missense possibly damaging 0.78
R5369:Snrnp40 UTSW 4 130362646 missense probably damaging 0.97
R5699:Snrnp40 UTSW 4 130365165 missense possibly damaging 0.78
R7529:Snrnp40 UTSW 4 130384482 missense possibly damaging 0.94
R8264:Snrnp40 UTSW 4 130378074 missense probably benign 0.00
R8412:Snrnp40 UTSW 4 130384523 missense possibly damaging 0.49
R9319:Snrnp40 UTSW 4 130362752 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- TGAGCTAAAGTCACAGTGCAGCAG -3'
(R):5'- TGCTTTGGAATACTGGCAGGAAGAC -3'

Sequencing Primer
(F):5'- aaagacagcatcagttacaacc -3'
(R):5'- CAGGATAGAGATTACATTATGCCACC -3'
Posted On 2013-06-11