Incidental Mutation 'R5756:Ggt5'
ID445054
Institutional Source Beutler Lab
Gene Symbol Ggt5
Ensembl Gene ENSMUSG00000006344
Gene Namegamma-glutamyltransferase 5
SynonymsGGL, Ggtla1, GGT-REL, gamma-glutamyl leukotrienase
MMRRC Submission 043359-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5756 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location75589340-75617200 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 75604773 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 243 (M243L)
Ref Sequence ENSEMBL: ENSMUSP00000072074 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072217] [ENSMUST00000189972] [ENSMUST00000218807]
Predicted Effect probably benign
Transcript: ENSMUST00000072217
AA Change: M243L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000072074
Gene: ENSMUSG00000006344
AA Change: M243L

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:G_glu_transpept 58 568 1.6e-164 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188444
Predicted Effect probably benign
Transcript: ENSMUST00000189972
SMART Domains Protein: ENSMUSP00000139459
Gene: ENSMUSG00000006344

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189991
Predicted Effect probably benign
Transcript: ENSMUST00000218807
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219214
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219247
Meta Mutation Damage Score 0.0970 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the gamma-glutamyl transpeptidase gene family, and some reports indicate that it is capable of cleaving the gamma-glutamyl moiety of glutathione. The protein encoded by this gene is synthesized as a single, catalytically-inactive polypeptide, that is processed post-transcriptionally to form a heavy and light subunit, with the catalytic activity contained within the small subunit. The encoded enzyme is able to convert leukotriene C4 to leukotriene D4, but appears to have distinct substrate specificity compared to gamma-glutamyl transpeptidase. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
PHENOTYPE: Homozygous mutants show an attenuation in neutrophil recruitment in an experimental model of peritonitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579C12Rik A G 9: 89,128,866 noncoding transcript Het
9330182L06Rik A C 5: 9,462,995 K996N probably damaging Het
Aqp6 A T 15: 99,602,742 I183F probably damaging Het
Asap1 A T 15: 64,167,707 M218K probably damaging Het
Astn2 G A 4: 66,119,188 probably benign Het
Bmp5 A G 9: 75,776,367 D92G probably benign Het
Cables1 A G 18: 11,941,353 D511G probably damaging Het
Cacna1e A G 1: 154,471,637 M928T probably benign Het
Calcoco1 T C 15: 102,719,651 N16S probably benign Het
Coro7 C T 16: 4,632,284 R567Q probably damaging Het
Dgki C T 6: 36,937,058 probably benign Het
Dusp11 T C 6: 85,952,357 I147V probably damaging Het
Eif2ak4 T C 2: 118,462,740 I1259T possibly damaging Het
Etfdh T C 3: 79,613,756 I219V probably benign Het
Ffar4 C T 19: 38,113,958 T347I probably damaging Het
Fgf3 G A 7: 144,842,951 S234N probably benign Het
Fnta A T 8: 26,009,707 I155N possibly damaging Het
Gcm2 G A 13: 41,109,896 T20M probably damaging Het
Ggta1 T C 2: 35,402,383 Y304C probably damaging Het
Gm16432 A T 1: 178,116,227 Q710L unknown Het
Gm5454 A G 13: 103,356,347 noncoding transcript Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hrc T C 7: 45,336,706 V427A possibly damaging Het
Ibtk C G 9: 85,731,254 V219L possibly damaging Het
Ift140 A G 17: 25,028,813 H215R possibly damaging Het
Itln1 A G 1: 171,516,917 probably benign Het
Kif13b T C 14: 64,736,305 I368T probably damaging Het
Lars2 T C 9: 123,438,199 Y529H probably damaging Het
Lrrc55 G A 2: 85,196,383 T99I probably benign Het
Mycbp2 A T 14: 103,133,974 I4156N probably damaging Het
Myo1c T G 11: 75,658,414 M137R probably benign Het
Olfr640 T C 7: 104,021,682 D212G probably damaging Het
Olfr765 A G 10: 129,046,226 V279A probably benign Het
Olfr921 T A 9: 38,775,258 M1K probably null Het
Pde7a A G 3: 19,264,845 V12A probably benign Het
Phyhip T G 14: 70,467,092 C250W probably damaging Het
Pisd G A 5: 32,738,498 T412I probably damaging Het
Polr3c T C 3: 96,714,134 N444S probably damaging Het
Sart1 T C 19: 5,380,469 E750G probably damaging Het
Sh3rf3 T C 10: 59,104,382 V675A probably damaging Het
Slc4a11 G T 2: 130,687,863 D307E probably benign Het
Slc6a16 A T 7: 45,260,850 I315F possibly damaging Het
Smarca5 A C 8: 80,710,604 S708A probably benign Het
Sv2c T C 13: 95,985,967 I434V probably benign Het
Tarsl2 A G 7: 65,675,976 K433E probably benign Het
Tbx15 A T 3: 99,313,086 I165F probably damaging Het
Tep1 C T 14: 50,837,379 probably null Het
Tex15 G A 8: 33,575,833 G1764S probably benign Het
Tnfrsf19 A G 14: 61,024,775 L13P probably benign Het
Tnnt3 G A 7: 142,502,758 probably null Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Usp24 T A 4: 106,362,483 I597K probably damaging Het
Usp40 C T 1: 87,951,691 R960Q possibly damaging Het
Vps53 A T 11: 76,092,330 probably benign Het
Xylt1 C T 7: 117,650,700 T699I probably damaging Het
Zfp81 A C 17: 33,334,333 Y502* probably null Het
Zfyve26 T A 12: 79,264,357 H145L probably damaging Het
Other mutations in Ggt5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01503:Ggt5 APN 10 75610110 splice site probably benign
IGL01926:Ggt5 APN 10 75604101 missense probably benign 0.00
IGL02095:Ggt5 APN 10 75608803 missense probably benign 0.01
IGL02252:Ggt5 APN 10 75602732 missense possibly damaging 0.51
IGL02393:Ggt5 APN 10 75610237 splice site probably benign
IGL02515:Ggt5 APN 10 75589770 missense probably benign 0.23
IGL02528:Ggt5 APN 10 75610420 splice site probably benign
IGL02964:Ggt5 APN 10 75604128 missense probably benign 0.08
R0646:Ggt5 UTSW 10 75602648 missense probably damaging 0.99
R0834:Ggt5 UTSW 10 75604770 missense possibly damaging 0.73
R1454:Ggt5 UTSW 10 75609908 missense probably benign 0.01
R1650:Ggt5 UTSW 10 75604761 missense probably benign 0.00
R1846:Ggt5 UTSW 10 75610542 splice site probably null
R1896:Ggt5 UTSW 10 75604726 missense probably damaging 1.00
R2044:Ggt5 UTSW 10 75604087 missense probably damaging 0.97
R2357:Ggt5 UTSW 10 75609241 missense probably benign 0.19
R3151:Ggt5 UTSW 10 75609242 missense probably benign 0.35
R4667:Ggt5 UTSW 10 75603031 missense probably damaging 1.00
R4669:Ggt5 UTSW 10 75603031 missense probably damaging 1.00
R5060:Ggt5 UTSW 10 75604774 missense probably benign
R6156:Ggt5 UTSW 10 75609326 missense probably damaging 1.00
R6162:Ggt5 UTSW 10 75589792 missense possibly damaging 0.92
R6900:Ggt5 UTSW 10 75610537 missense possibly damaging 0.81
R8258:Ggt5 UTSW 10 75614832 missense probably benign 0.04
R8259:Ggt5 UTSW 10 75614832 missense probably benign 0.04
Z1088:Ggt5 UTSW 10 75608759 missense possibly damaging 0.81
Z1176:Ggt5 UTSW 10 75602618 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TTTCTCTAGGGCTCTGCAGG -3'
(R):5'- TAAGGCTAGCAACGATCAGG -3'

Sequencing Primer
(F):5'- AGTGTCCTCTGAGATCTGGCATC -3'
(R):5'- CTAGCAACGATCAGGCTGGAC -3'
Posted On2016-11-21