Incidental Mutation 'R5756:Sv2c'
ID445061
Institutional Source Beutler Lab
Gene Symbol Sv2c
Ensembl Gene ENSMUSG00000051111
Gene Namesynaptic vesicle glycoprotein 2c
Synonyms4930527L09Rik
MMRRC Submission 043359-MU
Accession Numbers

Genbank: NM_029210; MGI: 1922459

Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R5756 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location95954594-96132577 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 95985967 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 434 (I434V)
Ref Sequence ENSEMBL: ENSMUSP00000138317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161263] [ENSMUST00000182289]
Predicted Effect probably benign
Transcript: ENSMUST00000161263
AA Change: I434V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124473
Gene: ENSMUSG00000051111
AA Change: I434V

DomainStartEndE-ValueType
low complexity region 51 61 N/A INTRINSIC
Pfam:Sugar_tr 117 428 9.1e-31 PFAM
Pfam:MFS_1 154 470 5e-27 PFAM
Pfam:Pentapeptide_4 496 573 4.8e-12 PFAM
Pfam:MFS_1 564 725 1.5e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182180
Predicted Effect probably benign
Transcript: ENSMUST00000182289
AA Change: I434V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000138317
Gene: ENSMUSG00000051111
AA Change: I434V

DomainStartEndE-ValueType
low complexity region 51 61 N/A INTRINSIC
Pfam:Sugar_tr 119 427 2.2e-30 PFAM
Pfam:MFS_1 154 470 5e-27 PFAM
Pfam:Pentapeptide_4 496 571 6.2e-15 PFAM
transmembrane domain 581 603 N/A INTRINSIC
transmembrane domain 610 632 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220740
Meta Mutation Damage Score 0.0707 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 100% (60/60)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit hypoactivity and increased anxiety-related response. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579C12Rik A G 9: 89,128,866 noncoding transcript Het
9330182L06Rik A C 5: 9,462,995 K996N probably damaging Het
Aqp6 A T 15: 99,602,742 I183F probably damaging Het
Asap1 A T 15: 64,167,707 M218K probably damaging Het
Astn2 G A 4: 66,119,188 probably benign Het
Bmp5 A G 9: 75,776,367 D92G probably benign Het
Cables1 A G 18: 11,941,353 D511G probably damaging Het
Cacna1e A G 1: 154,471,637 M928T probably benign Het
Calcoco1 T C 15: 102,719,651 N16S probably benign Het
Coro7 C T 16: 4,632,284 R567Q probably damaging Het
Dgki C T 6: 36,937,058 probably benign Het
Dusp11 T C 6: 85,952,357 I147V probably damaging Het
Eif2ak4 T C 2: 118,462,740 I1259T possibly damaging Het
Etfdh T C 3: 79,613,756 I219V probably benign Het
Ffar4 C T 19: 38,113,958 T347I probably damaging Het
Fgf3 G A 7: 144,842,951 S234N probably benign Het
Fnta A T 8: 26,009,707 I155N possibly damaging Het
Gcm2 G A 13: 41,109,896 T20M probably damaging Het
Ggt5 A T 10: 75,604,773 M243L probably benign Het
Ggta1 T C 2: 35,402,383 Y304C probably damaging Het
Gm16432 A T 1: 178,116,227 Q710L unknown Het
Gm5454 A G 13: 103,356,347 noncoding transcript Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hrc T C 7: 45,336,706 V427A possibly damaging Het
Ibtk C G 9: 85,731,254 V219L possibly damaging Het
Ift140 A G 17: 25,028,813 H215R possibly damaging Het
Itln1 A G 1: 171,516,917 probably benign Het
Kif13b T C 14: 64,736,305 I368T probably damaging Het
Lars2 T C 9: 123,438,199 Y529H probably damaging Het
Lrrc55 G A 2: 85,196,383 T99I probably benign Het
Mycbp2 A T 14: 103,133,974 I4156N probably damaging Het
Myo1c T G 11: 75,658,414 M137R probably benign Het
Olfr640 T C 7: 104,021,682 D212G probably damaging Het
Olfr765 A G 10: 129,046,226 V279A probably benign Het
Olfr921 T A 9: 38,775,258 M1K probably null Het
Pde7a A G 3: 19,264,845 V12A probably benign Het
Phyhip T G 14: 70,467,092 C250W probably damaging Het
Pisd G A 5: 32,738,498 T412I probably damaging Het
Polr3c T C 3: 96,714,134 N444S probably damaging Het
Sart1 T C 19: 5,380,469 E750G probably damaging Het
Sh3rf3 T C 10: 59,104,382 V675A probably damaging Het
Slc4a11 G T 2: 130,687,863 D307E probably benign Het
Slc6a16 A T 7: 45,260,850 I315F possibly damaging Het
Smarca5 A C 8: 80,710,604 S708A probably benign Het
Tarsl2 A G 7: 65,675,976 K433E probably benign Het
Tbx15 A T 3: 99,313,086 I165F probably damaging Het
Tep1 C T 14: 50,837,379 probably null Het
Tex15 G A 8: 33,575,833 G1764S probably benign Het
Tnfrsf19 A G 14: 61,024,775 L13P probably benign Het
Tnnt3 G A 7: 142,502,758 probably null Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Usp24 T A 4: 106,362,483 I597K probably damaging Het
Usp40 C T 1: 87,951,691 R960Q possibly damaging Het
Vps53 A T 11: 76,092,330 probably benign Het
Xylt1 C T 7: 117,650,700 T699I probably damaging Het
Zfp81 A C 17: 33,334,333 Y502* probably null Het
Zfyve26 T A 12: 79,264,357 H145L probably damaging Het
Other mutations in Sv2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Sv2c APN 13 96048429 missense probably damaging 1.00
IGL01313:Sv2c APN 13 96088289 missense probably damaging 1.00
IGL02710:Sv2c APN 13 95989141 missense probably damaging 0.99
IGL02990:Sv2c APN 13 96088378 missense probably damaging 1.00
IGL03145:Sv2c APN 13 95989098 missense probably damaging 1.00
D4043:Sv2c UTSW 13 96088481 missense probably benign 0.27
R0390:Sv2c UTSW 13 96088708 missense probably benign
R0849:Sv2c UTSW 13 95989811 missense probably damaging 1.00
R0907:Sv2c UTSW 13 96088255 missense probably damaging 1.00
R1177:Sv2c UTSW 13 95989763 missense possibly damaging 0.79
R1840:Sv2c UTSW 13 95981844 missense probably benign 0.08
R1865:Sv2c UTSW 13 95976775 missense probably benign 0.29
R1959:Sv2c UTSW 13 95976645 missense probably damaging 1.00
R2440:Sv2c UTSW 13 96048576 missense probably damaging 1.00
R4007:Sv2c UTSW 13 95986833 splice site probably benign
R4197:Sv2c UTSW 13 95978128 missense probably damaging 1.00
R4697:Sv2c UTSW 13 95986018 missense possibly damaging 0.64
R4719:Sv2c UTSW 13 95986811 missense probably benign 0.21
R4822:Sv2c UTSW 13 95985949 missense probably damaging 1.00
R5237:Sv2c UTSW 13 95981883 missense possibly damaging 0.76
R5452:Sv2c UTSW 13 95978083 missense probably damaging 1.00
R5531:Sv2c UTSW 13 95961378 missense probably damaging 0.98
R5982:Sv2c UTSW 13 95976063 nonsense probably null
R6220:Sv2c UTSW 13 95976626 missense probably damaging 1.00
R6511:Sv2c UTSW 13 96048525 missense probably benign 0.00
R6520:Sv2c UTSW 13 95986721 missense probably benign
R7001:Sv2c UTSW 13 95981953 missense probably benign 0.11
R7073:Sv2c UTSW 13 96088250 missense probably damaging 1.00
R7116:Sv2c UTSW 13 95976644 missense probably damaging 1.00
R7261:Sv2c UTSW 13 96088301 missense probably damaging 1.00
R7374:Sv2c UTSW 13 95989136 missense probably damaging 1.00
R7423:Sv2c UTSW 13 96048548 missense probably benign 0.03
R7626:Sv2c UTSW 13 95985943 missense probably benign 0.13
R7727:Sv2c UTSW 13 95976695 missense possibly damaging 0.89
R7767:Sv2c UTSW 13 95989715 missense probably damaging 1.00
R7818:Sv2c UTSW 13 95986820 nonsense probably null
R7831:Sv2c UTSW 13 95976692 missense probably damaging 1.00
R7914:Sv2c UTSW 13 95976692 missense probably damaging 1.00
Z1176:Sv2c UTSW 13 95976097 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCGGAATTCTAGCAAGTTAGCAG -3'
(R):5'- GTCCGCATTGGCTTTTCAG -3'

Sequencing Primer
(F):5'- CTAGCAAGTTAGCAGAATTGAGTC -3'
(R):5'- CTCTAGCACACATGAGGTTCTAGG -3'
Posted On2016-11-21