Incidental Mutation 'R5756:Sv2c'
ID 445061
Institutional Source Beutler Lab
Gene Symbol Sv2c
Ensembl Gene ENSMUSG00000051111
Gene Name synaptic vesicle glycoprotein 2c
Synonyms 4930527L09Rik
MMRRC Submission 043359-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.053) question?
Stock # R5756 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 96091102-96269085 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 96122475 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 434 (I434V)
Ref Sequence ENSEMBL: ENSMUSP00000138317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161263] [ENSMUST00000182289]
AlphaFold Q69ZS6
Predicted Effect probably benign
Transcript: ENSMUST00000161263
AA Change: I434V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124473
Gene: ENSMUSG00000051111
AA Change: I434V

DomainStartEndE-ValueType
low complexity region 51 61 N/A INTRINSIC
Pfam:Sugar_tr 117 428 9.1e-31 PFAM
Pfam:MFS_1 154 470 5e-27 PFAM
Pfam:Pentapeptide_4 496 573 4.8e-12 PFAM
Pfam:MFS_1 564 725 1.5e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182180
Predicted Effect probably benign
Transcript: ENSMUST00000182289
AA Change: I434V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000138317
Gene: ENSMUSG00000051111
AA Change: I434V

DomainStartEndE-ValueType
low complexity region 51 61 N/A INTRINSIC
Pfam:Sugar_tr 119 427 2.2e-30 PFAM
Pfam:MFS_1 154 470 5e-27 PFAM
Pfam:Pentapeptide_4 496 571 6.2e-15 PFAM
transmembrane domain 581 603 N/A INTRINSIC
transmembrane domain 610 632 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220740
Meta Mutation Damage Score 0.0707 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 100% (60/60)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit hypoactivity and increased anxiety-related response. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579C12Rik A G 9: 89,010,919 (GRCm39) noncoding transcript Het
Aqp6 A T 15: 99,500,623 (GRCm39) I183F probably damaging Het
Asap1 A T 15: 64,039,556 (GRCm39) M218K probably damaging Het
Astn2 G A 4: 66,037,425 (GRCm39) probably benign Het
Bmp5 A G 9: 75,683,649 (GRCm39) D92G probably benign Het
Cables1 A G 18: 12,074,410 (GRCm39) D511G probably damaging Het
Cacna1e A G 1: 154,347,383 (GRCm39) M928T probably benign Het
Calcoco1 T C 15: 102,628,086 (GRCm39) N16S probably benign Het
Catspere2 A T 1: 177,943,793 (GRCm39) Q710L unknown Het
Coro7 C T 16: 4,450,148 (GRCm39) R567Q probably damaging Het
Dgki C T 6: 36,913,993 (GRCm39) probably benign Het
Dusp11 T C 6: 85,929,339 (GRCm39) I147V probably damaging Het
Eif2ak4 T C 2: 118,293,221 (GRCm39) I1259T possibly damaging Het
Elapor2 A C 5: 9,512,995 (GRCm39) K996N probably damaging Het
Etfdh T C 3: 79,521,063 (GRCm39) I219V probably benign Het
Ffar4 C T 19: 38,102,406 (GRCm39) T347I probably damaging Het
Fgf3 G A 7: 144,396,688 (GRCm39) S234N probably benign Het
Fnta A T 8: 26,499,735 (GRCm39) I155N possibly damaging Het
Gcm2 G A 13: 41,263,372 (GRCm39) T20M probably damaging Het
Ggt5 A T 10: 75,440,607 (GRCm39) M243L probably benign Het
Ggta1 T C 2: 35,292,395 (GRCm39) Y304C probably damaging Het
Gm5454 A G 13: 103,492,855 (GRCm39) noncoding transcript Het
Gprc5c G T 11: 114,755,093 (GRCm39) V257L possibly damaging Het
Hrc T C 7: 44,986,130 (GRCm39) V427A possibly damaging Het
Ibtk C G 9: 85,613,307 (GRCm39) V219L possibly damaging Het
Ift140 A G 17: 25,247,787 (GRCm39) H215R possibly damaging Het
Itln1 A G 1: 171,344,485 (GRCm39) probably benign Het
Kif13b T C 14: 64,973,754 (GRCm39) I368T probably damaging Het
Lars2 T C 9: 123,267,264 (GRCm39) Y529H probably damaging Het
Lrrc55 G A 2: 85,026,727 (GRCm39) T99I probably benign Het
Mycbp2 A T 14: 103,371,410 (GRCm39) I4156N probably damaging Het
Myo1c T G 11: 75,549,240 (GRCm39) M137R probably benign Het
Or51i1 T C 7: 103,670,889 (GRCm39) D212G probably damaging Het
Or6c8b A G 10: 128,882,095 (GRCm39) V279A probably benign Het
Or8b54 T A 9: 38,686,554 (GRCm39) M1K probably null Het
Pde7a A G 3: 19,319,009 (GRCm39) V12A probably benign Het
Phyhip T G 14: 70,704,532 (GRCm39) C250W probably damaging Het
Pisd G A 5: 32,895,842 (GRCm39) T412I probably damaging Het
Polr3c T C 3: 96,621,450 (GRCm39) N444S probably damaging Het
Sart1 T C 19: 5,430,497 (GRCm39) E750G probably damaging Het
Sh3rf3 T C 10: 58,940,204 (GRCm39) V675A probably damaging Het
Slc4a11 G T 2: 130,529,783 (GRCm39) D307E probably benign Het
Slc6a16 A T 7: 44,910,274 (GRCm39) I315F possibly damaging Het
Smarca5 A C 8: 81,437,233 (GRCm39) S708A probably benign Het
Tars3 A G 7: 65,325,724 (GRCm39) K433E probably benign Het
Tbx15 A T 3: 99,220,402 (GRCm39) I165F probably damaging Het
Tep1 C T 14: 51,074,836 (GRCm39) probably null Het
Tex15 G A 8: 34,065,861 (GRCm39) G1764S probably benign Het
Tnfrsf19 A G 14: 61,262,224 (GRCm39) L13P probably benign Het
Tnnt3 G A 7: 142,056,495 (GRCm39) probably null Het
Ttc23l G T 15: 10,551,636 (GRCm39) T30K possibly damaging Het
Usp24 T A 4: 106,219,680 (GRCm39) I597K probably damaging Het
Usp40 C T 1: 87,879,413 (GRCm39) R960Q possibly damaging Het
Vps53 A T 11: 75,983,156 (GRCm39) probably benign Het
Xylt1 C T 7: 117,249,927 (GRCm39) T699I probably damaging Het
Zfp81 A C 17: 33,553,307 (GRCm39) Y502* probably null Het
Zfyve26 T A 12: 79,311,131 (GRCm39) H145L probably damaging Het
Other mutations in Sv2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Sv2c APN 13 96,184,937 (GRCm39) missense probably damaging 1.00
IGL01313:Sv2c APN 13 96,224,797 (GRCm39) missense probably damaging 1.00
IGL02710:Sv2c APN 13 96,125,649 (GRCm39) missense probably damaging 0.99
IGL02990:Sv2c APN 13 96,224,886 (GRCm39) missense probably damaging 1.00
IGL03145:Sv2c APN 13 96,125,606 (GRCm39) missense probably damaging 1.00
D4043:Sv2c UTSW 13 96,224,989 (GRCm39) missense probably benign 0.27
R0390:Sv2c UTSW 13 96,225,216 (GRCm39) missense probably benign
R0849:Sv2c UTSW 13 96,126,319 (GRCm39) missense probably damaging 1.00
R0907:Sv2c UTSW 13 96,224,763 (GRCm39) missense probably damaging 1.00
R1177:Sv2c UTSW 13 96,126,271 (GRCm39) missense possibly damaging 0.79
R1840:Sv2c UTSW 13 96,118,352 (GRCm39) missense probably benign 0.08
R1865:Sv2c UTSW 13 96,113,283 (GRCm39) missense probably benign 0.29
R1959:Sv2c UTSW 13 96,113,153 (GRCm39) missense probably damaging 1.00
R2440:Sv2c UTSW 13 96,185,084 (GRCm39) missense probably damaging 1.00
R4007:Sv2c UTSW 13 96,123,341 (GRCm39) splice site probably benign
R4197:Sv2c UTSW 13 96,114,636 (GRCm39) missense probably damaging 1.00
R4697:Sv2c UTSW 13 96,122,526 (GRCm39) missense possibly damaging 0.64
R4719:Sv2c UTSW 13 96,123,319 (GRCm39) missense probably benign 0.21
R4822:Sv2c UTSW 13 96,122,457 (GRCm39) missense probably damaging 1.00
R5237:Sv2c UTSW 13 96,118,391 (GRCm39) missense possibly damaging 0.76
R5452:Sv2c UTSW 13 96,114,591 (GRCm39) missense probably damaging 1.00
R5531:Sv2c UTSW 13 96,097,886 (GRCm39) missense probably damaging 0.98
R5982:Sv2c UTSW 13 96,112,571 (GRCm39) nonsense probably null
R6220:Sv2c UTSW 13 96,113,134 (GRCm39) missense probably damaging 1.00
R6511:Sv2c UTSW 13 96,185,033 (GRCm39) missense probably benign 0.00
R6520:Sv2c UTSW 13 96,123,229 (GRCm39) missense probably benign
R7001:Sv2c UTSW 13 96,118,461 (GRCm39) missense probably benign 0.11
R7073:Sv2c UTSW 13 96,224,758 (GRCm39) missense probably damaging 1.00
R7116:Sv2c UTSW 13 96,113,152 (GRCm39) missense probably damaging 1.00
R7261:Sv2c UTSW 13 96,224,809 (GRCm39) missense probably damaging 1.00
R7374:Sv2c UTSW 13 96,125,644 (GRCm39) missense probably damaging 1.00
R7423:Sv2c UTSW 13 96,185,056 (GRCm39) missense probably benign 0.03
R7626:Sv2c UTSW 13 96,122,451 (GRCm39) missense probably benign 0.13
R7727:Sv2c UTSW 13 96,113,203 (GRCm39) missense possibly damaging 0.89
R7767:Sv2c UTSW 13 96,126,223 (GRCm39) missense probably damaging 1.00
R7818:Sv2c UTSW 13 96,123,328 (GRCm39) nonsense probably null
R7831:Sv2c UTSW 13 96,113,200 (GRCm39) missense probably damaging 1.00
R7991:Sv2c UTSW 13 96,224,797 (GRCm39) missense probably damaging 1.00
R8137:Sv2c UTSW 13 96,225,171 (GRCm39) missense probably damaging 0.96
R8254:Sv2c UTSW 13 96,225,073 (GRCm39) missense probably damaging 1.00
R9192:Sv2c UTSW 13 96,224,755 (GRCm39) missense probably benign 0.00
R9203:Sv2c UTSW 13 96,224,745 (GRCm39) nonsense probably null
R9278:Sv2c UTSW 13 96,112,589 (GRCm39) missense probably damaging 0.98
R9547:Sv2c UTSW 13 96,185,008 (GRCm39) missense probably benign 0.03
R9585:Sv2c UTSW 13 96,122,466 (GRCm39) missense probably benign
Z1176:Sv2c UTSW 13 96,112,605 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GCGGAATTCTAGCAAGTTAGCAG -3'
(R):5'- GTCCGCATTGGCTTTTCAG -3'

Sequencing Primer
(F):5'- CTAGCAAGTTAGCAGAATTGAGTC -3'
(R):5'- CTCTAGCACACATGAGGTTCTAGG -3'
Posted On 2016-11-21