Incidental Mutation 'R5756:Cables1'
ID445074
Institutional Source Beutler Lab
Gene Symbol Cables1
Ensembl Gene ENSMUSG00000040957
Gene NameCDK5 and Abl enzyme substrate 1
Synonymsik3-1, interactor-1 with cdk3
MMRRC Submission 043359-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.573) question?
Stock #R5756 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location11839220-11945630 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 11941353 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 511 (D511G)
Ref Sequence ENSEMBL: ENSMUSP00000040639 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046948] [ENSMUST00000171109]
Predicted Effect probably damaging
Transcript: ENSMUST00000046948
AA Change: D511G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000040639
Gene: ENSMUSG00000040957
AA Change: D511G

DomainStartEndE-ValueType
low complexity region 2 31 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
low complexity region 81 88 N/A INTRINSIC
low complexity region 93 102 N/A INTRINSIC
low complexity region 108 138 N/A INTRINSIC
low complexity region 184 201 N/A INTRINSIC
low complexity region 238 253 N/A INTRINSIC
CYCLIN 456 544 1.83e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171109
AA Change: D537G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000129463
Gene: ENSMUSG00000040957
AA Change: D537G

DomainStartEndE-ValueType
low complexity region 2 31 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
low complexity region 81 88 N/A INTRINSIC
low complexity region 93 102 N/A INTRINSIC
low complexity region 108 138 N/A INTRINSIC
low complexity region 184 201 N/A INTRINSIC
low complexity region 238 253 N/A INTRINSIC
CYCLIN 482 570 1.83e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225430
Meta Mutation Damage Score 0.6791 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in regulation of the cell cycle through interactions with several cyclin-dependent kinases. One study (PMID: 16177568) reported aberrant splicing of transcripts from this gene which results in removal of the cyclin binding domain only in human cancer cells, and reduction in gene expression was shown in colorectal cancers (PMID: 17982127).Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous null females exhibited reduced fertility and uterine hyperplasia. With chronic exposure to estrogen, homozygous females develop endometrial adenocarcinoma. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579C12Rik A G 9: 89,128,866 noncoding transcript Het
9330182L06Rik A C 5: 9,462,995 K996N probably damaging Het
Aqp6 A T 15: 99,602,742 I183F probably damaging Het
Asap1 A T 15: 64,167,707 M218K probably damaging Het
Astn2 G A 4: 66,119,188 probably benign Het
Bmp5 A G 9: 75,776,367 D92G probably benign Het
Cacna1e A G 1: 154,471,637 M928T probably benign Het
Calcoco1 T C 15: 102,719,651 N16S probably benign Het
Coro7 C T 16: 4,632,284 R567Q probably damaging Het
Dgki C T 6: 36,937,058 probably benign Het
Dusp11 T C 6: 85,952,357 I147V probably damaging Het
Eif2ak4 T C 2: 118,462,740 I1259T possibly damaging Het
Etfdh T C 3: 79,613,756 I219V probably benign Het
Ffar4 C T 19: 38,113,958 T347I probably damaging Het
Fgf3 G A 7: 144,842,951 S234N probably benign Het
Fnta A T 8: 26,009,707 I155N possibly damaging Het
Gcm2 G A 13: 41,109,896 T20M probably damaging Het
Ggt5 A T 10: 75,604,773 M243L probably benign Het
Ggta1 T C 2: 35,402,383 Y304C probably damaging Het
Gm16432 A T 1: 178,116,227 Q710L unknown Het
Gm5454 A G 13: 103,356,347 noncoding transcript Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hrc T C 7: 45,336,706 V427A possibly damaging Het
Ibtk C G 9: 85,731,254 V219L possibly damaging Het
Ift140 A G 17: 25,028,813 H215R possibly damaging Het
Itln1 A G 1: 171,516,917 probably benign Het
Kif13b T C 14: 64,736,305 I368T probably damaging Het
Lars2 T C 9: 123,438,199 Y529H probably damaging Het
Lrrc55 G A 2: 85,196,383 T99I probably benign Het
Mycbp2 A T 14: 103,133,974 I4156N probably damaging Het
Myo1c T G 11: 75,658,414 M137R probably benign Het
Olfr640 T C 7: 104,021,682 D212G probably damaging Het
Olfr765 A G 10: 129,046,226 V279A probably benign Het
Olfr921 T A 9: 38,775,258 M1K probably null Het
Pde7a A G 3: 19,264,845 V12A probably benign Het
Phyhip T G 14: 70,467,092 C250W probably damaging Het
Pisd G A 5: 32,738,498 T412I probably damaging Het
Polr3c T C 3: 96,714,134 N444S probably damaging Het
Sart1 T C 19: 5,380,469 E750G probably damaging Het
Sh3rf3 T C 10: 59,104,382 V675A probably damaging Het
Slc4a11 G T 2: 130,687,863 D307E probably benign Het
Slc6a16 A T 7: 45,260,850 I315F possibly damaging Het
Smarca5 A C 8: 80,710,604 S708A probably benign Het
Sv2c T C 13: 95,985,967 I434V probably benign Het
Tarsl2 A G 7: 65,675,976 K433E probably benign Het
Tbx15 A T 3: 99,313,086 I165F probably damaging Het
Tep1 C T 14: 50,837,379 probably null Het
Tex15 G A 8: 33,575,833 G1764S probably benign Het
Tnfrsf19 A G 14: 61,024,775 L13P probably benign Het
Tnnt3 G A 7: 142,502,758 probably null Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Usp24 T A 4: 106,362,483 I597K probably damaging Het
Usp40 C T 1: 87,951,691 R960Q possibly damaging Het
Vps53 A T 11: 76,092,330 probably benign Het
Xylt1 C T 7: 117,650,700 T699I probably damaging Het
Zfp81 A C 17: 33,334,333 Y502* probably null Het
Zfyve26 T A 12: 79,264,357 H145L probably damaging Het
Other mutations in Cables1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01289:Cables1 APN 18 11944564 missense probably damaging 0.99
IGL01373:Cables1 APN 18 11888764 missense probably damaging 0.98
R0058:Cables1 UTSW 18 11923413 missense possibly damaging 0.80
R0058:Cables1 UTSW 18 11923413 missense possibly damaging 0.80
R2886:Cables1 UTSW 18 11939732 missense possibly damaging 0.80
R4691:Cables1 UTSW 18 11840523 nonsense probably null
R4845:Cables1 UTSW 18 11944488 missense probably damaging 0.99
R4964:Cables1 UTSW 18 11941277 missense possibly damaging 0.92
R5286:Cables1 UTSW 18 11924827 missense probably benign 0.11
R6755:Cables1 UTSW 18 11939825 missense probably null 1.00
R7162:Cables1 UTSW 18 11926366 critical splice donor site probably null
R7242:Cables1 UTSW 18 11840007 missense possibly damaging 0.93
R7410:Cables1 UTSW 18 11941225 missense probably benign
R7411:Cables1 UTSW 18 11840515 missense probably benign 0.01
R7965:Cables1 UTSW 18 11840212 missense probably benign 0.06
Z1177:Cables1 UTSW 18 11941317 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTAGCCTGAAAAGAGAGATGC -3'
(R):5'- GGCTGTGCGAATAACTATCCC -3'

Sequencing Primer
(F):5'- CGGAAGCTTGCCCAGGAG -3'
(R):5'- TATCCCTCATGCTAGCTGAGAAAGG -3'
Posted On2016-11-21