Incidental Mutation 'R5756:Ffar4'
ID445076
Institutional Source Beutler Lab
Gene Symbol Ffar4
Ensembl Gene ENSMUSG00000054200
Gene Namefree fatty acid receptor 4
SynonymsGpr129, O3far1, Pgr4, Gpr120
MMRRC Submission 043359-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R5756 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location38097079-38114263 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 38113958 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 347 (T347I)
Ref Sequence ENSEMBL: ENSMUSP00000063660 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025951] [ENSMUST00000067098] [ENSMUST00000112335]
Predicted Effect probably benign
Transcript: ENSMUST00000025951
SMART Domains Protein: ENSMUSP00000025951
Gene: ENSMUSG00000024990

DomainStartEndE-ValueType
low complexity region 47 60 N/A INTRINSIC
Pfam:Lipocalin_2 77 229 8.2e-9 PFAM
Pfam:Lipocalin 83 229 8.3e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000067098
AA Change: T347I

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000063660
Gene: ENSMUSG00000054200
AA Change: T347I

DomainStartEndE-ValueType
Pfam:7tm_1 57 321 1.7e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112335
SMART Domains Protein: ENSMUSP00000107954
Gene: ENSMUSG00000024990

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Lipocalin_2 33 186 3.6e-9 PFAM
Pfam:Lipocalin 39 185 6.5e-21 PFAM
Meta Mutation Damage Score 0.0950 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a G protein-coupled receptor (GPR) which belongs to the rhodopsin family of GPRs. The encoded protein functions as a receptor for free fatty acids, including omega-3, and participates in suppressing anti-inflammatory responses and insulin sensitizing. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygotes for a null allele show altered taste responses to fatty acids. Homozygotes for another null allele develop obesity, liver steatosis, and impaired glucose metabolism, adipogenesis and lipogenesis on a high-fat diet. Homozygotes for a third allele show altered islet somatostatin secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579C12Rik A G 9: 89,128,866 noncoding transcript Het
9330182L06Rik A C 5: 9,462,995 K996N probably damaging Het
Aqp6 A T 15: 99,602,742 I183F probably damaging Het
Asap1 A T 15: 64,167,707 M218K probably damaging Het
Astn2 G A 4: 66,119,188 probably benign Het
Bmp5 A G 9: 75,776,367 D92G probably benign Het
Cables1 A G 18: 11,941,353 D511G probably damaging Het
Cacna1e A G 1: 154,471,637 M928T probably benign Het
Calcoco1 T C 15: 102,719,651 N16S probably benign Het
Coro7 C T 16: 4,632,284 R567Q probably damaging Het
Dgki C T 6: 36,937,058 probably benign Het
Dusp11 T C 6: 85,952,357 I147V probably damaging Het
Eif2ak4 T C 2: 118,462,740 I1259T possibly damaging Het
Etfdh T C 3: 79,613,756 I219V probably benign Het
Fgf3 G A 7: 144,842,951 S234N probably benign Het
Fnta A T 8: 26,009,707 I155N possibly damaging Het
Gcm2 G A 13: 41,109,896 T20M probably damaging Het
Ggt5 A T 10: 75,604,773 M243L probably benign Het
Ggta1 T C 2: 35,402,383 Y304C probably damaging Het
Gm16432 A T 1: 178,116,227 Q710L unknown Het
Gm5454 A G 13: 103,356,347 noncoding transcript Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hrc T C 7: 45,336,706 V427A possibly damaging Het
Ibtk C G 9: 85,731,254 V219L possibly damaging Het
Ift140 A G 17: 25,028,813 H215R possibly damaging Het
Itln1 A G 1: 171,516,917 probably benign Het
Kif13b T C 14: 64,736,305 I368T probably damaging Het
Lars2 T C 9: 123,438,199 Y529H probably damaging Het
Lrrc55 G A 2: 85,196,383 T99I probably benign Het
Mycbp2 A T 14: 103,133,974 I4156N probably damaging Het
Myo1c T G 11: 75,658,414 M137R probably benign Het
Olfr640 T C 7: 104,021,682 D212G probably damaging Het
Olfr765 A G 10: 129,046,226 V279A probably benign Het
Olfr921 T A 9: 38,775,258 M1K probably null Het
Pde7a A G 3: 19,264,845 V12A probably benign Het
Phyhip T G 14: 70,467,092 C250W probably damaging Het
Pisd G A 5: 32,738,498 T412I probably damaging Het
Polr3c T C 3: 96,714,134 N444S probably damaging Het
Sart1 T C 19: 5,380,469 E750G probably damaging Het
Sh3rf3 T C 10: 59,104,382 V675A probably damaging Het
Slc4a11 G T 2: 130,687,863 D307E probably benign Het
Slc6a16 A T 7: 45,260,850 I315F possibly damaging Het
Smarca5 A C 8: 80,710,604 S708A probably benign Het
Sv2c T C 13: 95,985,967 I434V probably benign Het
Tarsl2 A G 7: 65,675,976 K433E probably benign Het
Tbx15 A T 3: 99,313,086 I165F probably damaging Het
Tep1 C T 14: 50,837,379 probably null Het
Tex15 G A 8: 33,575,833 G1764S probably benign Het
Tnfrsf19 A G 14: 61,024,775 L13P probably benign Het
Tnnt3 G A 7: 142,502,758 probably null Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Usp24 T A 4: 106,362,483 I597K probably damaging Het
Usp40 C T 1: 87,951,691 R960Q possibly damaging Het
Vps53 A T 11: 76,092,330 probably benign Het
Xylt1 C T 7: 117,650,700 T699I probably damaging Het
Zfp81 A C 17: 33,334,333 Y502* probably null Het
Zfyve26 T A 12: 79,264,357 H145L probably damaging Het
Other mutations in Ffar4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Ffar4 APN 19 38107389 missense probably benign
IGL01734:Ffar4 APN 19 38113847 missense probably damaging 1.00
IGL01932:Ffar4 APN 19 38097530 missense probably damaging 1.00
IGL02160:Ffar4 APN 19 38097455 missense possibly damaging 0.91
IGL02486:Ffar4 APN 19 38113760 missense possibly damaging 0.68
R0047:Ffar4 UTSW 19 38114004 unclassified probably benign
R0492:Ffar4 UTSW 19 38097182 missense probably benign
R4956:Ffar4 UTSW 19 38097580 missense probably benign 0.01
R5091:Ffar4 UTSW 19 38097179 missense probably benign
R5634:Ffar4 UTSW 19 38113925 unclassified probably benign
R6778:Ffar4 UTSW 19 38113664 missense possibly damaging 0.56
R8030:Ffar4 UTSW 19 38107391 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- AAGACTACCGACTCTTCCGC -3'
(R):5'- GCTCCAAGGTTTGTTTCAGC -3'

Sequencing Primer
(F):5'- ATGTGGAGTCCCATCATCATCAC -3'
(R):5'- CCAAGGTTTGTTTCAGCAATCAC -3'
Posted On2016-11-21