Incidental Mutation 'R5757:Ccdc150'
ID445078
Institutional Source Beutler Lab
Gene Symbol Ccdc150
Ensembl Gene ENSMUSG00000025983
Gene Namecoiled-coil domain containing 150
Synonyms4930511H11Rik
MMRRC Submission 043360-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R5757 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location54250683-54368727 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 54263620 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 133 (I133N)
Ref Sequence ENSEMBL: ENSMUSP00000125195 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027128] [ENSMUST00000160472]
Predicted Effect probably damaging
Transcript: ENSMUST00000027128
AA Change: I133N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027128
Gene: ENSMUSG00000025983
AA Change: I133N

DomainStartEndE-ValueType
coiled coil region 160 250 N/A INTRINSIC
coiled coil region 288 314 N/A INTRINSIC
coiled coil region 418 676 N/A INTRINSIC
coiled coil region 727 952 N/A INTRINSIC
coiled coil region 985 1048 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160472
AA Change: I133N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125195
Gene: ENSMUSG00000025983
AA Change: I133N

DomainStartEndE-ValueType
coiled coil region 160 250 N/A INTRINSIC
coiled coil region 288 314 N/A INTRINSIC
coiled coil region 418 551 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161988
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a C T 11: 110,042,968 A1204T probably benign Het
Adcy5 G T 16: 35,272,081 R604L probably damaging Het
Ago4 A T 4: 126,526,084 N33K probably damaging Het
Arid5b T C 10: 68,102,079 Y406C probably damaging Het
Asgr1 A C 11: 70,054,952 H18P probably benign Het
Asph A C 4: 9,637,722 probably null Het
Brd4 G A 17: 32,201,298 probably benign Het
Cdon A C 9: 35,452,772 H62P probably damaging Het
Clec4b1 T A 6: 123,069,754 Y157* probably null Het
Clip1 G A 5: 123,627,397 T810I probably benign Het
Crocc A T 4: 141,043,564 L184Q probably damaging Het
Fat2 C T 11: 55,252,346 G4226R probably damaging Het
Fbxo30 T A 10: 11,290,421 C296S probably benign Het
Fndc3a T C 14: 72,556,585 K883E probably benign Het
Glyr1 A T 16: 5,018,992 M436K probably benign Het
Gm525 A T 11: 89,075,046 Q38L probably benign Het
Gnas T A 2: 174,345,247 V941D probably damaging Het
Hectd4 G C 5: 121,348,619 E3226Q possibly damaging Het
Ints13 G A 6: 146,550,106 R714C probably benign Het
Kif12 A T 4: 63,170,518 W182R probably damaging Het
Kif21a A G 15: 90,951,345 L1272P probably damaging Het
Klhl14 A C 18: 21,554,734 Y544D probably damaging Het
Kntc1 T C 5: 123,807,309 probably null Het
Lama1 G A 17: 67,738,787 R229Q possibly damaging Het
Ltbp1 T A 17: 75,273,949 probably null Het
Map4k5 A T 12: 69,824,655 C498S probably damaging Het
Myh9 A T 15: 77,771,162 V1198E probably benign Het
Ncoa6 T C 2: 155,411,608 D950G probably damaging Het
Obsl1 G T 1: 75,493,055 A1106D probably damaging Het
Olfr1034 T A 2: 86,046,566 V28E possibly damaging Het
Olfr1065 T C 2: 86,445,578 I135V probably benign Het
Otog T A 7: 46,241,121 probably null Het
Oxtr A T 6: 112,477,261 I14N probably damaging Het
Pfkfb3 A T 2: 11,480,330 S490R probably damaging Het
Polk A C 13: 96,484,252 M560R probably benign Het
Polq C T 16: 37,086,681 H2335Y probably benign Het
Prr14 T A 7: 127,475,553 V419D possibly damaging Het
Rflnb A G 11: 76,022,166 V132A probably damaging Het
Rxfp1 T G 3: 79,661,320 I283L possibly damaging Het
Ryr3 G A 2: 112,841,975 R1384C probably damaging Het
Scnn1g T A 7: 121,738,215 C100S probably damaging Het
Sfrp2 G C 3: 83,766,626 G29R possibly damaging Het
Spop A G 11: 95,490,382 H312R probably damaging Het
Tpx2 A G 2: 152,885,231 probably null Het
Wdr4 A T 17: 31,499,089 V337E probably damaging Het
Zbtb11 A G 16: 56,007,029 N953D probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Ccdc150
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00712:Ccdc150 APN 1 54272550 splice site probably benign
IGL00819:Ccdc150 APN 1 54263573 missense probably damaging 1.00
IGL01973:Ccdc150 APN 1 54300488 splice site probably null
IGL02352:Ccdc150 APN 1 54272521 missense probably benign 0.25
IGL02359:Ccdc150 APN 1 54272521 missense probably benign 0.25
IGL02620:Ccdc150 APN 1 54263545 nonsense probably null
IGL02673:Ccdc150 APN 1 54328990 missense probably benign 0.09
IGL03148:Ccdc150 APN 1 54278715 missense possibly damaging 0.68
IGL03185:Ccdc150 APN 1 54300323 missense probably damaging 1.00
IGL03014:Ccdc150 UTSW 1 54290702 missense probably damaging 0.99
R0066:Ccdc150 UTSW 1 54356691 missense probably benign
R0066:Ccdc150 UTSW 1 54356691 missense probably benign
R0217:Ccdc150 UTSW 1 54300430 missense possibly damaging 0.87
R0582:Ccdc150 UTSW 1 54329511 missense probably benign
R0687:Ccdc150 UTSW 1 54285631 splice site probably null
R0790:Ccdc150 UTSW 1 54277776 splice site probably benign
R1146:Ccdc150 UTSW 1 54364971 splice site probably benign
R1288:Ccdc150 UTSW 1 54364458 missense probably damaging 1.00
R1763:Ccdc150 UTSW 1 54354636 missense probably benign 0.42
R1855:Ccdc150 UTSW 1 54367910 intron probably benign
R1957:Ccdc150 UTSW 1 54263909 missense probably benign 0.00
R2180:Ccdc150 UTSW 1 54272547 critical splice donor site probably null
R2226:Ccdc150 UTSW 1 54364925 missense probably null 0.11
R3054:Ccdc150 UTSW 1 54288842 missense possibly damaging 0.51
R3055:Ccdc150 UTSW 1 54288842 missense possibly damaging 0.51
R3056:Ccdc150 UTSW 1 54288842 missense possibly damaging 0.51
R3409:Ccdc150 UTSW 1 54356773 missense probably benign 0.02
R3411:Ccdc150 UTSW 1 54356773 missense probably benign 0.02
R3812:Ccdc150 UTSW 1 54368310 missense probably benign 0.00
R4031:Ccdc150 UTSW 1 54278811 missense probably benign 0.31
R4356:Ccdc150 UTSW 1 54353054 missense probably damaging 0.98
R4617:Ccdc150 UTSW 1 54355754 missense probably benign 0.00
R4757:Ccdc150 UTSW 1 54278715 missense possibly damaging 0.81
R4957:Ccdc150 UTSW 1 54364868 intron probably benign
R5028:Ccdc150 UTSW 1 54263477 missense probably benign 0.01
R5512:Ccdc150 UTSW 1 54354647 missense probably damaging 0.96
R5943:Ccdc150 UTSW 1 54300367 missense probably benign 0.01
R5948:Ccdc150 UTSW 1 54277714 missense possibly damaging 0.79
R6033:Ccdc150 UTSW 1 54285628 critical splice donor site probably null
R6033:Ccdc150 UTSW 1 54285628 critical splice donor site probably null
R6065:Ccdc150 UTSW 1 54263599 missense possibly damaging 0.90
R6390:Ccdc150 UTSW 1 54368017 missense probably benign 0.01
R6399:Ccdc150 UTSW 1 54263957 splice site probably null
R6988:Ccdc150 UTSW 1 54355709 nonsense probably null
R7248:Ccdc150 UTSW 1 54304898 missense probably benign 0.00
R7319:Ccdc150 UTSW 1 54263337 intron probably null
R7322:Ccdc150 UTSW 1 54259966 missense probably benign 0.01
R7366:Ccdc150 UTSW 1 54300382 nonsense probably null
R7647:Ccdc150 UTSW 1 54356704 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCTGGCTTACCACAGTAG -3'
(R):5'- TGATCGTTCAGAAAAGCTATGC -3'

Sequencing Primer
(F):5'- GGCTGGCTTACCACAGTAGAAATTC -3'
(R):5'- TCGTTCAGAAAAGCTATGCACAGC -3'
Posted On2016-11-21