Incidental Mutation 'R0027:Rad9b'
ID44508
Institutional Source Beutler Lab
Gene Symbol Rad9b
Ensembl Gene ENSMUSG00000038569
Gene NameRAD9 checkpoint clamp component B
SynonymsA630082N15Rik
MMRRC Submission 038322-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0027 (G1) of strain 730
Quality Score173
Status Validated (trace)
Chromosome5
Chromosomal Location122323223-122354233 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 122351723 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049009] [ENSMUST00000111729] [ENSMUST00000117263] [ENSMUST00000117868] [ENSMUST00000118765] [ENSMUST00000118830] [ENSMUST00000144268] [ENSMUST00000145821] [ENSMUST00000154686] [ENSMUST00000155671]
Predicted Effect probably benign
Transcript: ENSMUST00000049009
SMART Domains Protein: ENSMUSP00000036177
Gene: ENSMUSG00000038569

DomainStartEndE-ValueType
Pfam:Rad9 14 271 1.8e-91 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111729
SMART Domains Protein: ENSMUSP00000107358
Gene: ENSMUSG00000029462

DomainStartEndE-ValueType
low complexity region 26 42 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117263
SMART Domains Protein: ENSMUSP00000113868
Gene: ENSMUSG00000038569

DomainStartEndE-ValueType
Pfam:Rad9 14 271 1.1e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117868
SMART Domains Protein: ENSMUSP00000113345
Gene: ENSMUSG00000029462

DomainStartEndE-ValueType
Pfam:Metallophos_2 1 143 1.1e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118765
SMART Domains Protein: ENSMUSP00000112579
Gene: ENSMUSG00000029462

DomainStartEndE-ValueType
PDB:1W24|A 1 65 7e-42 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000118830
SMART Domains Protein: ENSMUSP00000113525
Gene: ENSMUSG00000029462

DomainStartEndE-ValueType
Pfam:Metallophos_2 6 162 1.6e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132785
Predicted Effect probably benign
Transcript: ENSMUST00000144268
SMART Domains Protein: ENSMUSP00000117334
Gene: ENSMUSG00000038569

DomainStartEndE-ValueType
Pfam:Rad9 1 64 6.7e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145821
SMART Domains Protein: ENSMUSP00000123593
Gene: ENSMUSG00000029462

DomainStartEndE-ValueType
Pfam:Metallophos_2 11 124 1e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149600
SMART Domains Protein: ENSMUSP00000120843
Gene: ENSMUSG00000038569

DomainStartEndE-ValueType
Pfam:Rad9 1 85 4.3e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154686
Predicted Effect probably benign
Transcript: ENSMUST00000155671
SMART Domains Protein: ENSMUSP00000121020
Gene: ENSMUSG00000029462

DomainStartEndE-ValueType
Pfam:Metallophos_2 1 158 3.4e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200653
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 98% (65/66)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality, decreased forebrain and somite cell proliferation, and increased cellular sensitivity to gamma irradiation and mitomycin C. Mice heterozygous for a knock-out allele exhibit reduced embryonic, fetal, and early postnatal survival. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts12 A T 15: 11,285,873 I723F probably damaging Het
Anapc1 G T 2: 128,641,511 D1221E possibly damaging Het
Arhgef28 T A 13: 97,945,696 E1201V possibly damaging Het
Capn12 T A 7: 28,881,960 H79Q probably benign Het
Caprin1 A T 2: 103,775,580 probably benign Het
Carmil3 T A 14: 55,494,403 F196Y probably damaging Het
Casp8ap2 A G 4: 32,643,810 H961R probably benign Het
Cdkl3 C T 11: 52,032,349 probably benign Het
Cic T A 7: 25,287,140 S1299T probably damaging Het
Cic C A 7: 25,287,141 S1299Y probably damaging Het
Col13a1 A G 10: 61,850,161 L684P unknown Het
D10Wsu102e G A 10: 83,364,529 probably benign Het
D430041D05Rik A T 2: 104,255,044 F1053L probably benign Het
Dab1 T C 4: 104,704,199 probably benign Het
Dmxl1 A T 18: 49,957,295 probably benign Het
Dst C T 1: 34,189,119 P1606L probably damaging Het
E130309D02Rik G A 5: 143,308,062 T220I probably damaging Het
Eml1 T C 12: 108,536,298 C708R possibly damaging Het
Fam131b T A 6: 42,318,248 M304L probably benign Het
Foxk1 A T 5: 142,450,340 I321F probably damaging Het
Gm10306 C T 4: 94,556,790 probably benign Het
Gm10985 TA TANA 3: 53,845,256 probably null Het
Gse1 T C 8: 120,566,546 probably benign Het
Hcn3 A G 3: 89,159,825 S79P probably damaging Het
Hspa4 T A 11: 53,283,585 M203L probably benign Het
Kctd7 G A 5: 130,152,573 R279H probably damaging Het
Kif11 C T 19: 37,406,983 probably benign Het
Klf13 T C 7: 63,891,761 N206S probably benign Het
Kpna7 A T 5: 144,989,697 Y482N probably damaging Het
Lamc1 T C 1: 153,262,583 Y175C probably damaging Het
Lrpprc G A 17: 84,767,007 R491* probably null Het
Madd T A 2: 91,152,549 I1350F probably damaging Het
Mbtd1 T C 11: 93,924,549 V321A possibly damaging Het
Mon2 G A 10: 123,036,048 S357L possibly damaging Het
Ndst3 A G 3: 123,671,513 V270A probably damaging Het
Nlrp2 T C 7: 5,322,448 T742A probably damaging Het
Olfr214 T C 6: 116,556,949 S175P probably damaging Het
Papola A C 12: 105,833,136 S675R probably benign Het
Pcdh9 T A 14: 93,888,645 I30F probably null Het
Prl6a1 T A 13: 27,318,028 L126Q probably damaging Het
Prr29 A G 11: 106,376,276 E89G possibly damaging Het
Psmd1 T C 1: 86,094,265 probably benign Het
Rest T C 5: 77,282,551 V939A probably benign Het
Rnf135 T A 11: 80,193,942 S180R probably benign Het
Sarm1 C A 11: 78,488,091 R376L probably damaging Het
Scap C A 9: 110,379,730 P613Q probably benign Het
Scube3 C T 17: 28,164,357 R374* probably null Het
Setx T G 2: 29,139,221 V167G probably damaging Het
Snrnp40 T A 4: 130,368,273 H151Q probably damaging Het
Sox21 G T 14: 118,235,617 H7N probably benign Het
Stard9 A T 2: 120,703,501 Q3413L probably benign Het
Sycp1 A G 3: 102,895,910 V528A probably benign Het
Tcl1b3 A T 12: 105,191,239 S47C probably damaging Het
Treml4 T C 17: 48,264,934 S122P possibly damaging Het
Trip11 C T 12: 101,885,169 A879T probably benign Het
Ubr4 C A 4: 139,400,393 N567K probably damaging Het
Zan T C 5: 137,406,519 probably benign Het
Zfp804a G A 2: 82,257,200 D458N probably damaging Het
Zic2 T C 14: 122,476,343 M223T possibly damaging Het
Other mutations in Rad9b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Rad9b APN 5 122344247 missense probably benign 0.01
IGL02375:Rad9b APN 5 122333342 missense possibly damaging 0.71
R0027:Rad9b UTSW 5 122351723 unclassified probably benign
R0103:Rad9b UTSW 5 122331527 missense probably damaging 0.99
R0103:Rad9b UTSW 5 122331527 missense probably damaging 0.99
R0975:Rad9b UTSW 5 122334257 splice site probably null
R2006:Rad9b UTSW 5 122339779 missense possibly damaging 0.74
R2265:Rad9b UTSW 5 122351342 missense probably damaging 0.98
R4818:Rad9b UTSW 5 122339776 missense probably damaging 1.00
R5392:Rad9b UTSW 5 122351578 missense probably damaging 1.00
R6041:Rad9b UTSW 5 122351352 missense probably damaging 0.99
R6109:Rad9b UTSW 5 122344297 missense probably damaging 1.00
R6133:Rad9b UTSW 5 122339768 missense possibly damaging 0.79
R6566:Rad9b UTSW 5 122352567 missense probably damaging 1.00
R6695:Rad9b UTSW 5 122351691 missense probably damaging 1.00
R7295:Rad9b UTSW 5 122334278 missense possibly damaging 0.95
R7299:Rad9b UTSW 5 122352614 missense possibly damaging 0.87
R7301:Rad9b UTSW 5 122352614 missense possibly damaging 0.87
R8495:Rad9b UTSW 5 122333033 splice site probably null
Z1088:Rad9b UTSW 5 122333372 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GCATTTATCCGCTCTGGCGACTAC -3'
(R):5'- CAGGCAAGGTATGAGGTCAGTCAC -3'

Sequencing Primer
(F):5'- TTGGCAGAACTGACTGCAATAC -3'
(R):5'- CACTGACAGTTTTACGGTATCAGAG -3'
Posted On2013-06-11