Incidental Mutation 'R5757:Pfkfb3'
ID445083
Institutional Source Beutler Lab
Gene Symbol Pfkfb3
Ensembl Gene ENSMUSG00000026773
Gene Name6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3
SynonymsE330010H22Rik, uPFK-2
MMRRC Submission 043360-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5757 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location11471433-11554077 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 11480330 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 490 (S490R)
Ref Sequence ENSEMBL: ENSMUSP00000142079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028114] [ENSMUST00000049849] [ENSMUST00000100411] [ENSMUST00000114844] [ENSMUST00000114845] [ENSMUST00000114846] [ENSMUST00000170196] [ENSMUST00000171188] [ENSMUST00000179584] [ENSMUST00000183869] [ENSMUST00000191668] [ENSMUST00000192949] [ENSMUST00000195779]
Predicted Effect probably damaging
Transcript: ENSMUST00000028114
AA Change: S461R

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000028114
Gene: ENSMUSG00000026773
AA Change: S461R

DomainStartEndE-ValueType
Pfam:6PF2K 24 246 2.6e-110 PFAM
Pfam:KTI12 36 218 7e-9 PFAM
Pfam:AAA_33 37 191 1.7e-10 PFAM
PGAM 248 395 5.09e-12 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000049849
AA Change: S461R

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000050926
Gene: ENSMUSG00000026773
AA Change: S461R

DomainStartEndE-ValueType
Pfam:6PF2K 24 246 3.3e-110 PFAM
Pfam:KTI12 36 218 9.7e-9 PFAM
Pfam:AAA_33 37 191 1.9e-10 PFAM
PGAM 248 395 5.09e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000100411
AA Change: S461R

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000097979
Gene: ENSMUSG00000026773
AA Change: S461R

DomainStartEndE-ValueType
Pfam:6PF2K 24 246 5.8e-110 PFAM
Pfam:KTI12 36 219 9.6e-9 PFAM
Pfam:AAA_33 37 191 2.4e-10 PFAM
PGAM 248 395 5.09e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114844
AA Change: S490R

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000110493
Gene: ENSMUSG00000026773
AA Change: S490R

DomainStartEndE-ValueType
Pfam:6PF2K 24 246 6.6e-110 PFAM
Pfam:KTI12 36 218 1.1e-8 PFAM
Pfam:AAA_33 37 191 2.6e-10 PFAM
PGAM 248 395 5.09e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114845
AA Change: S461R

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000110494
Gene: ENSMUSG00000026773
AA Change: S461R

DomainStartEndE-ValueType
Pfam:6PF2K 24 246 2.6e-110 PFAM
Pfam:KTI12 36 218 7e-9 PFAM
Pfam:AAA_33 37 191 1.7e-10 PFAM
PGAM 248 395 5.09e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114846
AA Change: S461R

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000110495
Gene: ENSMUSG00000026773
AA Change: S461R

DomainStartEndE-ValueType
Pfam:6PF2K 24 246 3.1e-110 PFAM
Pfam:KTI12 36 219 9e-9 PFAM
Pfam:AAA_33 37 191 1.9e-10 PFAM
PGAM 248 395 5.09e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150086
Predicted Effect probably damaging
Transcript: ENSMUST00000170196
AA Change: S490R

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000126305
Gene: ENSMUSG00000026773
AA Change: S490R

DomainStartEndE-ValueType
Pfam:6PF2K 24 246 3.4e-110 PFAM
Pfam:KTI12 36 218 9.9e-9 PFAM
Pfam:AAA_33 37 191 2e-10 PFAM
PGAM 248 395 5.09e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171188
AA Change: S490R

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000129122
Gene: ENSMUSG00000026773
AA Change: S490R

DomainStartEndE-ValueType
Pfam:6PF2K 24 246 3.2e-110 PFAM
Pfam:KTI12 36 209 4.2e-8 PFAM
Pfam:AAA_33 37 167 1.8e-9 PFAM
PGAM 248 395 5.09e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000179584
AA Change: S490R

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000137130
Gene: ENSMUSG00000026773
AA Change: S490R

DomainStartEndE-ValueType
Pfam:6PF2K 24 246 2.3e-110 PFAM
Pfam:KTI12 36 225 7e-9 PFAM
Pfam:AAA_33 37 191 1.5e-10 PFAM
PGAM 248 395 5.09e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183869
SMART Domains Protein: ENSMUSP00000138893
Gene: ENSMUSG00000026773

DomainStartEndE-ValueType
Pfam:6PF2K 24 246 2.3e-110 PFAM
Pfam:KTI12 36 225 7e-9 PFAM
Pfam:AAA_33 37 191 1.5e-10 PFAM
PGAM 248 395 5.09e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000191668
AA Change: S490R

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142079
Gene: ENSMUSG00000026773
AA Change: S490R

DomainStartEndE-ValueType
Pfam:6PF2K 24 246 3.6e-110 PFAM
Pfam:KTI12 36 218 1e-8 PFAM
Pfam:AAA_33 37 191 2.1e-10 PFAM
PGAM 248 395 5.09e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191726
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192844
Predicted Effect probably damaging
Transcript: ENSMUST00000192949
AA Change: S441R

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000142296
Gene: ENSMUSG00000026773
AA Change: S441R

DomainStartEndE-ValueType
Pfam:6PF2K 3 226 1.9e-107 PFAM
Pfam:KTI12 16 200 3.9e-6 PFAM
Pfam:AAA_33 17 171 1.9e-8 PFAM
PGAM 228 375 3.8e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195779
SMART Domains Protein: ENSMUSP00000141445
Gene: ENSMUSG00000026773

DomainStartEndE-ValueType
Pfam:6PF2K 3 159 1.3e-69 PFAM
Pfam:KTI12 16 212 1.8e-6 PFAM
Pfam:AAA_33 17 163 1.6e-9 PFAM
Pfam:6PF2K 158 242 2.2e-32 PFAM
Pfam:His_Phos_1 244 326 3.4e-13 PFAM
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of bifunctional proteins that are involved in both the synthesis and degradation of fructose-2,6-bisphosphate, a regulatory molecule that controls glycolysis in eukaryotes. The encoded protein has a 6-phosphofructo-2-kinase activity that catalyzes the synthesis of fructose-2,6-bisphosphate (F2,6BP), and a fructose-2,6-biphosphatase activity that catalyzes the degradation of F2,6BP. This protein is required for cell cycle progression and prevention of apoptosis. It functions as a regulator of cyclin-dependent kinase 1, linking glucose metabolism to cell proliferation and survival in tumor cells. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygous null mice display embryonic lethality before E8 [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a C T 11: 110,042,968 A1204T probably benign Het
Adcy5 G T 16: 35,272,081 R604L probably damaging Het
Ago4 A T 4: 126,526,084 N33K probably damaging Het
Arid5b T C 10: 68,102,079 Y406C probably damaging Het
Asgr1 A C 11: 70,054,952 H18P probably benign Het
Asph A C 4: 9,637,722 probably null Het
Brd4 G A 17: 32,201,298 probably benign Het
Ccdc150 T A 1: 54,263,620 I133N probably damaging Het
Cdon A C 9: 35,452,772 H62P probably damaging Het
Clec4b1 T A 6: 123,069,754 Y157* probably null Het
Clip1 G A 5: 123,627,397 T810I probably benign Het
Crocc A T 4: 141,043,564 L184Q probably damaging Het
Fat2 C T 11: 55,252,346 G4226R probably damaging Het
Fbxo30 T A 10: 11,290,421 C296S probably benign Het
Fndc3a T C 14: 72,556,585 K883E probably benign Het
Glyr1 A T 16: 5,018,992 M436K probably benign Het
Gm525 A T 11: 89,075,046 Q38L probably benign Het
Gnas T A 2: 174,345,247 V941D probably damaging Het
Hectd4 G C 5: 121,348,619 E3226Q possibly damaging Het
Ints13 G A 6: 146,550,106 R714C probably benign Het
Kif12 A T 4: 63,170,518 W182R probably damaging Het
Kif21a A G 15: 90,951,345 L1272P probably damaging Het
Klhl14 A C 18: 21,554,734 Y544D probably damaging Het
Kntc1 T C 5: 123,807,309 probably null Het
Lama1 G A 17: 67,738,787 R229Q possibly damaging Het
Ltbp1 T A 17: 75,273,949 probably null Het
Map4k5 A T 12: 69,824,655 C498S probably damaging Het
Myh9 A T 15: 77,771,162 V1198E probably benign Het
Ncoa6 T C 2: 155,411,608 D950G probably damaging Het
Obsl1 G T 1: 75,493,055 A1106D probably damaging Het
Olfr1034 T A 2: 86,046,566 V28E possibly damaging Het
Olfr1065 T C 2: 86,445,578 I135V probably benign Het
Otog T A 7: 46,241,121 probably null Het
Oxtr A T 6: 112,477,261 I14N probably damaging Het
Polk A C 13: 96,484,252 M560R probably benign Het
Polq C T 16: 37,086,681 H2335Y probably benign Het
Prr14 T A 7: 127,475,553 V419D possibly damaging Het
Rflnb A G 11: 76,022,166 V132A probably damaging Het
Rxfp1 T G 3: 79,661,320 I283L possibly damaging Het
Ryr3 G A 2: 112,841,975 R1384C probably damaging Het
Scnn1g T A 7: 121,738,215 C100S probably damaging Het
Sfrp2 G C 3: 83,766,626 G29R possibly damaging Het
Spop A G 11: 95,490,382 H312R probably damaging Het
Tpx2 A G 2: 152,885,231 probably null Het
Wdr4 A T 17: 31,499,089 V337E probably damaging Het
Zbtb11 A G 16: 56,007,029 N953D probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Pfkfb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00767:Pfkfb3 APN 2 11488754 missense probably damaging 1.00
IGL01651:Pfkfb3 APN 2 11489684 missense probably damaging 0.97
IGL02010:Pfkfb3 APN 2 11483994 missense probably benign
IGL02546:Pfkfb3 APN 2 11488778 missense probably damaging 1.00
IGL03182:Pfkfb3 APN 2 11501663 missense probably damaging 0.99
R1491:Pfkfb3 UTSW 2 11493936 missense probably damaging 1.00
R2365:Pfkfb3 UTSW 2 11493902 critical splice donor site probably null
R2919:Pfkfb3 UTSW 2 11484327 missense probably benign 0.00
R2920:Pfkfb3 UTSW 2 11484327 missense probably benign 0.00
R4709:Pfkfb3 UTSW 2 11493908 missense probably damaging 1.00
R4863:Pfkfb3 UTSW 2 11486312 missense probably benign
R4915:Pfkfb3 UTSW 2 11490298 nonsense probably null
R5087:Pfkfb3 UTSW 2 11484014 missense probably damaging 1.00
R5109:Pfkfb3 UTSW 2 11486351 splice site probably benign
R5244:Pfkfb3 UTSW 2 11484849 missense probably damaging 1.00
R5488:Pfkfb3 UTSW 2 11484669 missense probably benign 0.00
R5573:Pfkfb3 UTSW 2 11501672 missense probably benign 0.28
R5619:Pfkfb3 UTSW 2 11484659 missense probably benign 0.00
R6015:Pfkfb3 UTSW 2 11481335 critical splice acceptor site probably null
R7495:Pfkfb3 UTSW 2 11482501 missense probably damaging 1.00
R7688:Pfkfb3 UTSW 2 11492639 missense probably damaging 1.00
R7813:Pfkfb3 UTSW 2 11481908 missense probably benign 0.12
X0024:Pfkfb3 UTSW 2 11482555 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAGATACGGGCATCCTCTTC -3'
(R):5'- GGTTGTACCTTTACAAGTCTCGAG -3'

Sequencing Primer
(F):5'- GGGCATCCTCTTCCCTCTG -3'
(R):5'- CTCGAGACGAATCTATGTGGTG -3'
Posted On2016-11-21