Incidental Mutation 'R5757:Prr14'
ID445102
Institutional Source Beutler Lab
Gene Symbol Prr14
Ensembl Gene ENSMUSG00000030822
Gene Nameproline rich 14
Synonyms
MMRRC Submission 043360-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R5757 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location127459611-127476759 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 127475553 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 419 (V419D)
Ref Sequence ENSEMBL: ENSMUSP00000101899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033095] [ENSMUST00000106292] [ENSMUST00000133817] [ENSMUST00000133938] [ENSMUST00000205432] [ENSMUST00000206394] [ENSMUST00000206915]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033095
AA Change: V419D

PolyPhen 2 Score 0.652 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000033095
Gene: ENSMUSG00000030822
AA Change: V419D

DomainStartEndE-ValueType
low complexity region 241 256 N/A INTRINSIC
low complexity region 263 273 N/A INTRINSIC
low complexity region 297 309 N/A INTRINSIC
low complexity region 364 387 N/A INTRINSIC
Pfam:Tantalus 485 545 5.6e-28 PFAM
low complexity region 554 564 N/A INTRINSIC
low complexity region 587 603 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106292
AA Change: V419D

PolyPhen 2 Score 0.652 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000101899
Gene: ENSMUSG00000030822
AA Change: V419D

DomainStartEndE-ValueType
low complexity region 241 256 N/A INTRINSIC
low complexity region 263 273 N/A INTRINSIC
low complexity region 297 309 N/A INTRINSIC
low complexity region 364 387 N/A INTRINSIC
Pfam:Tantalus 487 544 1.7e-26 PFAM
low complexity region 554 564 N/A INTRINSIC
low complexity region 587 603 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128805
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132124
Predicted Effect probably benign
Transcript: ENSMUST00000132819
Predicted Effect probably benign
Transcript: ENSMUST00000133817
Predicted Effect probably benign
Transcript: ENSMUST00000133938
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142532
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147202
Predicted Effect probably benign
Transcript: ENSMUST00000205432
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206118
Predicted Effect probably benign
Transcript: ENSMUST00000206394
Predicted Effect probably benign
Transcript: ENSMUST00000206915
AA Change: V12D

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206980
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene tethers heterochromatin to the nuclear laminar scaffold by binding heterochromatin protein 1 (HP1) and the nuclear lamina. The tether is broken during mitosis and reforms quickly after mitosis, with the encoded protein first binding HP1 and then attaching to the nuclear lamina. This protein also has been shown to promote MyoD activity and skeletal myogenesis. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a C T 11: 110,042,968 A1204T probably benign Het
Adcy5 G T 16: 35,272,081 R604L probably damaging Het
Ago4 A T 4: 126,526,084 N33K probably damaging Het
Arid5b T C 10: 68,102,079 Y406C probably damaging Het
Asgr1 A C 11: 70,054,952 H18P probably benign Het
Asph A C 4: 9,637,722 probably null Het
Brd4 G A 17: 32,201,298 probably benign Het
Ccdc150 T A 1: 54,263,620 I133N probably damaging Het
Cdon A C 9: 35,452,772 H62P probably damaging Het
Clec4b1 T A 6: 123,069,754 Y157* probably null Het
Clip1 G A 5: 123,627,397 T810I probably benign Het
Crocc A T 4: 141,043,564 L184Q probably damaging Het
Fat2 C T 11: 55,252,346 G4226R probably damaging Het
Fbxo30 T A 10: 11,290,421 C296S probably benign Het
Fndc3a T C 14: 72,556,585 K883E probably benign Het
Glyr1 A T 16: 5,018,992 M436K probably benign Het
Gm525 A T 11: 89,075,046 Q38L probably benign Het
Gnas T A 2: 174,345,247 V941D probably damaging Het
Hectd4 G C 5: 121,348,619 E3226Q possibly damaging Het
Ints13 G A 6: 146,550,106 R714C probably benign Het
Kif12 A T 4: 63,170,518 W182R probably damaging Het
Kif21a A G 15: 90,951,345 L1272P probably damaging Het
Klhl14 A C 18: 21,554,734 Y544D probably damaging Het
Kntc1 T C 5: 123,807,309 probably null Het
Lama1 G A 17: 67,738,787 R229Q possibly damaging Het
Ltbp1 T A 17: 75,273,949 probably null Het
Map4k5 A T 12: 69,824,655 C498S probably damaging Het
Myh9 A T 15: 77,771,162 V1198E probably benign Het
Ncoa6 T C 2: 155,411,608 D950G probably damaging Het
Obsl1 G T 1: 75,493,055 A1106D probably damaging Het
Olfr1034 T A 2: 86,046,566 V28E possibly damaging Het
Olfr1065 T C 2: 86,445,578 I135V probably benign Het
Otog T A 7: 46,241,121 probably null Het
Oxtr A T 6: 112,477,261 I14N probably damaging Het
Pfkfb3 A T 2: 11,480,330 S490R probably damaging Het
Polk A C 13: 96,484,252 M560R probably benign Het
Polq C T 16: 37,086,681 H2335Y probably benign Het
Rflnb A G 11: 76,022,166 V132A probably damaging Het
Rxfp1 T G 3: 79,661,320 I283L possibly damaging Het
Ryr3 G A 2: 112,841,975 R1384C probably damaging Het
Scnn1g T A 7: 121,738,215 C100S probably damaging Het
Sfrp2 G C 3: 83,766,626 G29R possibly damaging Het
Spop A G 11: 95,490,382 H312R probably damaging Het
Tpx2 A G 2: 152,885,231 probably null Het
Wdr4 A T 17: 31,499,089 V337E probably damaging Het
Zbtb11 A G 16: 56,007,029 N953D probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Prr14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00551:Prr14 APN 7 127474647 missense probably benign 0.01
IGL01614:Prr14 APN 7 127475133 missense probably damaging 1.00
IGL01655:Prr14 APN 7 127475767 missense probably benign 0.00
IGL02273:Prr14 APN 7 127475936 missense probably damaging 1.00
IGL03033:Prr14 APN 7 127471963 missense probably damaging 1.00
R0364:Prr14 UTSW 7 127474579 missense probably benign 0.01
R0376:Prr14 UTSW 7 127476643 missense probably benign 0.33
R0448:Prr14 UTSW 7 127474726 unclassified probably benign
R0555:Prr14 UTSW 7 127472095 unclassified probably benign
R1462:Prr14 UTSW 7 127473988 critical splice donor site probably null
R1462:Prr14 UTSW 7 127473988 critical splice donor site probably null
R1534:Prr14 UTSW 7 127473982 missense probably benign 0.08
R1982:Prr14 UTSW 7 127475490 missense possibly damaging 0.87
R2357:Prr14 UTSW 7 127475363 missense probably benign 0.02
R4729:Prr14 UTSW 7 127474696 missense probably benign 0.00
R5582:Prr14 UTSW 7 127476397 missense probably damaging 1.00
R6497:Prr14 UTSW 7 127474578 missense probably benign 0.03
R6987:Prr14 UTSW 7 127473805 missense possibly damaging 0.94
R7202:Prr14 UTSW 7 127476476 missense probably damaging 0.99
R7376:Prr14 UTSW 7 127476577 missense probably benign
R7380:Prr14 UTSW 7 127476442 missense probably null 1.00
R7426:Prr14 UTSW 7 127475286 missense probably benign 0.00
R7470:Prr14 UTSW 7 127475825 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TCATCTCTGGGACGAAGCTAC -3'
(R):5'- AACCTGCAGAGATGGTCAACAG -3'

Sequencing Primer
(F):5'- TCTGGGACGAAGCTACTCCTG -3'
(R):5'- TCAACAGTCAGGACAAGGGCATAC -3'
Posted On2016-11-21