Incidental Mutation 'R5757:Asgr1'
ID 445108
Institutional Source Beutler Lab
Gene Symbol Asgr1
Ensembl Gene ENSMUSG00000020884
Gene Name asialoglycoprotein receptor 1
Synonyms Asgr-1, Asgr, ASGPR1
MMRRC Submission 043360-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5757 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 70054085-70057894 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 70054952 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Proline at position 18 (H18P)
Ref Sequence ENSEMBL: ENSMUSP00000121842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018699] [ENSMUST00000092959] [ENSMUST00000108585] [ENSMUST00000123369] [ENSMUST00000146411]
AlphaFold P34927
Predicted Effect probably benign
Transcript: ENSMUST00000018699
AA Change: H18P

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000018699
Gene: ENSMUSG00000020884
AA Change: H18P

DomainStartEndE-ValueType
Pfam:Lectin_N 6 143 1.1e-67 PFAM
CLECT 153 277 2.23e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000092959
AA Change: H18P

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000090637
Gene: ENSMUSG00000020884
AA Change: H18P

DomainStartEndE-ValueType
Pfam:Lectin_N 6 143 1.1e-67 PFAM
CLECT 153 277 2.23e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108585
AA Change: H18P

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000104226
Gene: ENSMUSG00000020884
AA Change: H18P

DomainStartEndE-ValueType
Blast:GuKc 1 112 1e-24 BLAST
CLECT 124 248 2.23e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123369
SMART Domains Protein: ENSMUSP00000137469
Gene: ENSMUSG00000020884

DomainStartEndE-ValueType
Pfam:Lectin_N 1 43 2e-19 PFAM
CLECT 53 129 9.83e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146411
AA Change: H18P

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000121842
Gene: ENSMUSG00000020884
AA Change: H18P

DomainStartEndE-ValueType
Pfam:Lectin_N 13 143 4.7e-55 PFAM
CLECT 153 277 2.23e-40 SMART
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the asialoglycoprotein receptor. This receptor is a transmembrane protein that plays a critical role in serum glycoprotein homeostasis by mediating the endocytosis and lysosomal degradation of glycoproteins with exposed terminal galactose or N-acetylgalactosamine residues. The asialoglycoprotein receptor may facilitate hepatic infection by multiple viruses including hepatitis B, and is also a target for liver-specific drug delivery. The asialoglycoprotein receptor is a hetero-oligomeric protein composed of major and minor subunits, which are encoded by different genes. The protein encoded by this gene is the more abundant major subunit. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygous mutation of this gene results in impaired hepatic clearance of asialoglycoproteins. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a C T 11: 110,042,968 A1204T probably benign Het
Adcy5 G T 16: 35,272,081 R604L probably damaging Het
Ago4 A T 4: 126,526,084 N33K probably damaging Het
Arid5b T C 10: 68,102,079 Y406C probably damaging Het
Asph A C 4: 9,637,722 probably null Het
Brd4 G A 17: 32,201,298 probably benign Het
Ccdc150 T A 1: 54,263,620 I133N probably damaging Het
Cdon A C 9: 35,452,772 H62P probably damaging Het
Clec4b1 T A 6: 123,069,754 Y157* probably null Het
Clip1 G A 5: 123,627,397 T810I probably benign Het
Crocc A T 4: 141,043,564 L184Q probably damaging Het
Fat2 C T 11: 55,252,346 G4226R probably damaging Het
Fbxo30 T A 10: 11,290,421 C296S probably benign Het
Fndc3a T C 14: 72,556,585 K883E probably benign Het
Glyr1 A T 16: 5,018,992 M436K probably benign Het
Gm525 A T 11: 89,075,046 Q38L probably benign Het
Gnas T A 2: 174,345,247 V941D probably damaging Het
Hectd4 G C 5: 121,348,619 E3226Q possibly damaging Het
Ints13 G A 6: 146,550,106 R714C probably benign Het
Kif12 A T 4: 63,170,518 W182R probably damaging Het
Kif21a A G 15: 90,951,345 L1272P probably damaging Het
Klhl14 A C 18: 21,554,734 Y544D probably damaging Het
Kntc1 T C 5: 123,807,309 probably null Het
Lama1 G A 17: 67,738,787 R229Q possibly damaging Het
Ltbp1 T A 17: 75,273,949 probably null Het
Map4k5 A T 12: 69,824,655 C498S probably damaging Het
Myh9 A T 15: 77,771,162 V1198E probably benign Het
Ncoa6 T C 2: 155,411,608 D950G probably damaging Het
Obsl1 G T 1: 75,493,055 A1106D probably damaging Het
Olfr1034 T A 2: 86,046,566 V28E possibly damaging Het
Olfr1065 T C 2: 86,445,578 I135V probably benign Het
Otog T A 7: 46,241,121 probably null Het
Oxtr A T 6: 112,477,261 I14N probably damaging Het
Pfkfb3 A T 2: 11,480,330 S490R probably damaging Het
Polk A C 13: 96,484,252 M560R probably benign Het
Polq C T 16: 37,086,681 H2335Y probably benign Het
Prr14 T A 7: 127,475,553 V419D possibly damaging Het
Rflnb A G 11: 76,022,166 V132A probably damaging Het
Rxfp1 T G 3: 79,661,320 I283L possibly damaging Het
Ryr3 G A 2: 112,841,975 R1384C probably damaging Het
Scnn1g T A 7: 121,738,215 C100S probably damaging Het
Sfrp2 G C 3: 83,766,626 G29R possibly damaging Het
Spop A G 11: 95,490,382 H312R probably damaging Het
Tpx2 A G 2: 152,885,231 probably null Het
Wdr4 A T 17: 31,499,089 V337E probably damaging Het
Zbtb11 A G 16: 56,007,029 N953D probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Asgr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02651:Asgr1 APN 11 70057130 missense possibly damaging 0.65
R1371:Asgr1 UTSW 11 70056097 missense probably benign 0.04
R1471:Asgr1 UTSW 11 70056093 missense possibly damaging 0.82
R1980:Asgr1 UTSW 11 70054946 missense probably damaging 1.00
R2186:Asgr1 UTSW 11 70056249 missense probably benign 0.02
R6037:Asgr1 UTSW 11 70056421 missense probably benign 0.00
R6037:Asgr1 UTSW 11 70056421 missense probably benign 0.00
R6478:Asgr1 UTSW 11 70056894 missense possibly damaging 0.94
R6963:Asgr1 UTSW 11 70055968 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGAGACAGAAAGTATGTCCACC -3'
(R):5'- TGGGAGGAAGCTTGGACATC -3'

Sequencing Primer
(F):5'- TGTCCACCTAGTCAGATGTAAAAGG -3'
(R):5'- ACATCTGTCACTGAGGATGC -3'
Posted On 2016-11-21