Incidental Mutation 'R5757:Klhl14'
ID445123
Institutional Source Beutler Lab
Gene Symbol Klhl14
Ensembl Gene ENSMUSG00000042514
Gene Namekelch-like 14
Synonymsprintor, 6330403N15Rik
MMRRC Submission 043360-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R5757 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location21550377-21654718 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 21554734 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Aspartic acid at position 544 (Y544D)
Ref Sequence ENSEMBL: ENSMUSP00000113755 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049105] [ENSMUST00000122333]
Predicted Effect probably damaging
Transcript: ENSMUST00000049105
AA Change: Y544D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000042015
Gene: ENSMUSG00000042514
AA Change: Y544D

DomainStartEndE-ValueType
BTB 33 183 6.57e-25 SMART
BACK 191 281 2.61e-9 SMART
Kelch 325 374 1.63e-1 SMART
Kelch 375 426 3.66e-2 SMART
Kelch 427 473 5.05e-14 SMART
Kelch 474 520 1.79e-5 SMART
Kelch 521 572 3.06e-4 SMART
Kelch 573 622 5.29e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000122333
AA Change: Y544D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000113755
Gene: ENSMUSG00000042514
AA Change: Y544D

DomainStartEndE-ValueType
BTB 33 183 6.57e-25 SMART
BACK 191 281 2.61e-9 SMART
Kelch 325 374 1.63e-1 SMART
Kelch 375 426 3.66e-2 SMART
Kelch 427 473 5.05e-14 SMART
Kelch 474 520 1.79e-5 SMART
Kelch 521 572 3.06e-4 SMART
Kelch 573 622 5.29e-1 SMART
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Kelch-like gene family, whose members contain a BTB/POZ domain, a BACK domain, and several Kelch domains. The encoded protein possesses six Kelch domains and localizes to the endoplasmic reticulum, where it interacts with torsin-1A. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a C T 11: 110,042,968 A1204T probably benign Het
Adcy5 G T 16: 35,272,081 R604L probably damaging Het
Ago4 A T 4: 126,526,084 N33K probably damaging Het
Arid5b T C 10: 68,102,079 Y406C probably damaging Het
Asgr1 A C 11: 70,054,952 H18P probably benign Het
Asph A C 4: 9,637,722 probably null Het
Brd4 G A 17: 32,201,298 probably benign Het
Ccdc150 T A 1: 54,263,620 I133N probably damaging Het
Cdon A C 9: 35,452,772 H62P probably damaging Het
Clec4b1 T A 6: 123,069,754 Y157* probably null Het
Clip1 G A 5: 123,627,397 T810I probably benign Het
Crocc A T 4: 141,043,564 L184Q probably damaging Het
Fat2 C T 11: 55,252,346 G4226R probably damaging Het
Fbxo30 T A 10: 11,290,421 C296S probably benign Het
Fndc3a T C 14: 72,556,585 K883E probably benign Het
Glyr1 A T 16: 5,018,992 M436K probably benign Het
Gm525 A T 11: 89,075,046 Q38L probably benign Het
Gnas T A 2: 174,345,247 V941D probably damaging Het
Hectd4 G C 5: 121,348,619 E3226Q possibly damaging Het
Ints13 G A 6: 146,550,106 R714C probably benign Het
Kif12 A T 4: 63,170,518 W182R probably damaging Het
Kif21a A G 15: 90,951,345 L1272P probably damaging Het
Kntc1 T C 5: 123,807,309 probably null Het
Lama1 G A 17: 67,738,787 R229Q possibly damaging Het
Ltbp1 T A 17: 75,273,949 probably null Het
Map4k5 A T 12: 69,824,655 C498S probably damaging Het
Myh9 A T 15: 77,771,162 V1198E probably benign Het
Ncoa6 T C 2: 155,411,608 D950G probably damaging Het
Obsl1 G T 1: 75,493,055 A1106D probably damaging Het
Olfr1034 T A 2: 86,046,566 V28E possibly damaging Het
Olfr1065 T C 2: 86,445,578 I135V probably benign Het
Otog T A 7: 46,241,121 probably null Het
Oxtr A T 6: 112,477,261 I14N probably damaging Het
Pfkfb3 A T 2: 11,480,330 S490R probably damaging Het
Polk A C 13: 96,484,252 M560R probably benign Het
Polq C T 16: 37,086,681 H2335Y probably benign Het
Prr14 T A 7: 127,475,553 V419D possibly damaging Het
Rflnb A G 11: 76,022,166 V132A probably damaging Het
Rxfp1 T G 3: 79,661,320 I283L possibly damaging Het
Ryr3 G A 2: 112,841,975 R1384C probably damaging Het
Scnn1g T A 7: 121,738,215 C100S probably damaging Het
Sfrp2 G C 3: 83,766,626 G29R possibly damaging Het
Spop A G 11: 95,490,382 H312R probably damaging Het
Tpx2 A G 2: 152,885,231 probably null Het
Wdr4 A T 17: 31,499,089 V337E probably damaging Het
Zbtb11 A G 16: 56,007,029 N953D probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Klhl14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Klhl14 APN 18 21651864 missense probably benign 0.00
IGL01474:Klhl14 APN 18 21557854 missense probably damaging 0.99
IGL02005:Klhl14 APN 18 21624611 nonsense probably null
IGL02108:Klhl14 APN 18 21557920 missense probably damaging 0.98
IGL02371:Klhl14 APN 18 21652181 missense probably damaging 1.00
IGL03354:Klhl14 APN 18 21651728 missense probably damaging 1.00
P0027:Klhl14 UTSW 18 21558135 missense probably damaging 1.00
PIT4810001:Klhl14 UTSW 18 21557823 nonsense probably null
R0288:Klhl14 UTSW 18 21565563 missense probably damaging 1.00
R1419:Klhl14 UTSW 18 21652193 missense probably damaging 0.99
R1606:Klhl14 UTSW 18 21565532 missense possibly damaging 0.94
R1771:Klhl14 UTSW 18 21651620 missense probably damaging 0.97
R1928:Klhl14 UTSW 18 21651786 missense probably damaging 1.00
R1966:Klhl14 UTSW 18 21554673 missense probably damaging 1.00
R3624:Klhl14 UTSW 18 21557896 missense probably damaging 1.00
R4541:Klhl14 UTSW 18 21554639 nonsense probably null
R4664:Klhl14 UTSW 18 21554708 missense probably benign 0.06
R4856:Klhl14 UTSW 18 21557972 intron probably null
R4886:Klhl14 UTSW 18 21557972 intron probably null
R4893:Klhl14 UTSW 18 21557935 missense probably damaging 1.00
R5393:Klhl14 UTSW 18 21651994 missense probably benign 0.30
R5951:Klhl14 UTSW 18 21651620 missense probably damaging 0.97
R5958:Klhl14 UTSW 18 21565535 missense probably damaging 0.99
R7231:Klhl14 UTSW 18 21652136 missense probably damaging 0.99
R7519:Klhl14 UTSW 18 21651843 missense probably benign 0.36
R7527:Klhl14 UTSW 18 21651540 missense probably damaging 0.99
R7573:Klhl14 UTSW 18 21652154 missense probably benign 0.00
R7664:Klhl14 UTSW 18 21554649 missense probably damaging 1.00
R7737:Klhl14 UTSW 18 21558134 nonsense probably null
T0722:Klhl14 UTSW 18 21558135 missense probably damaging 1.00
X0026:Klhl14 UTSW 18 21651941 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GATGTCACTGGGTGATCAGG -3'
(R):5'- GTGCTAATGGTTCCCAGTTTCAC -3'

Sequencing Primer
(F):5'- TGTCACTGGGTGATCAGGAAAGG -3'
(R):5'- GCTAATGGTTCCCAGTTTCACTAATG -3'
Posted On2016-11-21