Mutagenetix > Incidental Mutations

Incidental Mutation 'R5757:Klhl14'

445123

Institutional Source

Beutler Lab

Gene Symbol

Klhl14

Ensembl Gene

ENSMUSG00000042514

Gene Name

kelch-like 14

Synonyms

printor, 6330403N15Rik

MMRRC Submission

043360-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.114) question?

Stock #

R5757 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

21550377-21654718 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 21554734 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Aspartic acid at position 544 (Y544D)

Ref Sequence

ENSEMBL: ENSMUSP00000113755 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049105] [ENSMUST00000122333]

Predicted Effect

probably damaging
Transcript: ENSMUST00000049105
AA Change: Y544D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000042015
Gene: ENSMUSG00000042514
AA Change: Y544D

Domain	Start	End	E-Value	Type
BTB	33	183	6.57e-25	SMART
BACK	191	281	2.61e-9	SMART
Kelch	325	374	1.63e-1	SMART
Kelch	375	426	3.66e-2	SMART
Kelch	427	473	5.05e-14	SMART
Kelch	474	520	1.79e-5	SMART
Kelch	521	572	3.06e-4	SMART
Kelch	573	622	5.29e-1	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000122333
AA Change: Y544D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000113755
Gene: ENSMUSG00000042514
AA Change: Y544D

Domain	Start	End	E-Value	Type
BTB	33	183	6.57e-25	SMART
BACK	191	281	2.61e-9	SMART
Kelch	325	374	1.63e-1	SMART
Kelch	375	426	3.66e-2	SMART
Kelch	427	473	5.05e-14	SMART
Kelch	474	520	1.79e-5	SMART
Kelch	521	572	3.06e-4	SMART
Kelch	573	622	5.29e-1	SMART

Coding Region Coverage

1x: 99.5%
3x: 98.8%
10x: 97.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Kelch-like gene family, whose members contain a BTB/POZ domain, a BACK domain, and several Kelch domains. The encoded protein possesses six Kelch domains and localizes to the endoplasmic reticulum, where it interacts with torsin-1A. [provided by RefSeq, Sep 2015]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8a	C	T	11: 110,042,968	A1204T	probably benign	Het
Adcy5	G	T	16: 35,272,081	R604L	probably damaging	Het
Ago4	A	T	4: 126,526,084	N33K	probably damaging	Het
Arid5b	T	C	10: 68,102,079	Y406C	probably damaging	Het
Asgr1	A	C	11: 70,054,952	H18P	probably benign	Het
Asph	A	C	4: 9,637,722		probably null	Het
Brd4	G	A	17: 32,201,298		probably benign	Het
Ccdc150	T	A	1: 54,263,620	I133N	probably damaging	Het
Cdon	A	C	9: 35,452,772	H62P	probably damaging	Het
Clec4b1	T	A	6: 123,069,754	Y157*	probably null	Het
Clip1	G	A	5: 123,627,397	T810I	probably benign	Het
Crocc	A	T	4: 141,043,564	L184Q	probably damaging	Het
Fat2	C	T	11: 55,252,346	G4226R	probably damaging	Het
Fbxo30	T	A	10: 11,290,421	C296S	probably benign	Het
Fndc3a	T	C	14: 72,556,585	K883E	probably benign	Het
Glyr1	A	T	16: 5,018,992	M436K	probably benign	Het
Gm525	A	T	11: 89,075,046	Q38L	probably benign	Het
Gnas	T	A	2: 174,345,247	V941D	probably damaging	Het
Hectd4	G	C	5: 121,348,619	E3226Q	possibly damaging	Het
Ints13	G	A	6: 146,550,106	R714C	probably benign	Het
Kif12	A	T	4: 63,170,518	W182R	probably damaging	Het
Kif21a	A	G	15: 90,951,345	L1272P	probably damaging	Het
Kntc1	T	C	5: 123,807,309		probably null	Het
Lama1	G	A	17: 67,738,787	R229Q	possibly damaging	Het
Ltbp1	T	A	17: 75,273,949		probably null	Het
Map4k5	A	T	12: 69,824,655	C498S	probably damaging	Het
Myh9	A	T	15: 77,771,162	V1198E	probably benign	Het
Ncoa6	T	C	2: 155,411,608	D950G	probably damaging	Het
Obsl1	G	T	1: 75,493,055	A1106D	probably damaging	Het
Olfr1034	T	A	2: 86,046,566	V28E	possibly damaging	Het
Olfr1065	T	C	2: 86,445,578	I135V	probably benign	Het
Otog	T	A	7: 46,241,121		probably null	Het
Oxtr	A	T	6: 112,477,261	I14N	probably damaging	Het
Pfkfb3	A	T	2: 11,480,330	S490R	probably damaging	Het
Polk	A	C	13: 96,484,252	M560R	probably benign	Het
Polq	C	T	16: 37,086,681	H2335Y	probably benign	Het
Prr14	T	A	7: 127,475,553	V419D	possibly damaging	Het
Rflnb	A	G	11: 76,022,166	V132A	probably damaging	Het
Rxfp1	T	G	3: 79,661,320	I283L	possibly damaging	Het
Ryr3	G	A	2: 112,841,975	R1384C	probably damaging	Het
Scnn1g	T	A	7: 121,738,215	C100S	probably damaging	Het
Sfrp2	G	C	3: 83,766,626	G29R	possibly damaging	Het
Spop	A	G	11: 95,490,382	H312R	probably damaging	Het
Tpx2	A	G	2: 152,885,231		probably null	Het
Wdr4	A	T	17: 31,499,089	V337E	probably damaging	Het
Zbtb11	A	G	16: 56,007,029	N953D	probably damaging	Het
Zfp703	C	T	8: 26,979,205	P299L	probably damaging	Het

Other mutations in Klhl14

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00340:Klhl14	APN	18	21651864	missense	probably benign	0.00
IGL01474:Klhl14	APN	18	21557854	missense	probably damaging	0.99
IGL02005:Klhl14	APN	18	21624611	nonsense	probably null
IGL02108:Klhl14	APN	18	21557920	missense	probably damaging	0.98
IGL02371:Klhl14	APN	18	21652181	missense	probably damaging	1.00
IGL03354:Klhl14	APN	18	21651728	missense	probably damaging	1.00
P0027:Klhl14	UTSW	18	21558135	missense	probably damaging	1.00
PIT4810001:Klhl14	UTSW	18	21557823	nonsense	probably null
R0288:Klhl14	UTSW	18	21565563	missense	probably damaging	1.00
R1419:Klhl14	UTSW	18	21652193	missense	probably damaging	0.99
R1606:Klhl14	UTSW	18	21565532	missense	possibly damaging	0.94
R1771:Klhl14	UTSW	18	21651620	missense	probably damaging	0.97
R1928:Klhl14	UTSW	18	21651786	missense	probably damaging	1.00
R1966:Klhl14	UTSW	18	21554673	missense	probably damaging	1.00
R3624:Klhl14	UTSW	18	21557896	missense	probably damaging	1.00
R4541:Klhl14	UTSW	18	21554639	nonsense	probably null
R4664:Klhl14	UTSW	18	21554708	missense	probably benign	0.06
R4856:Klhl14	UTSW	18	21557972	intron	probably null
R4886:Klhl14	UTSW	18	21557972	intron	probably null
R4893:Klhl14	UTSW	18	21557935	missense	probably damaging	1.00
R5393:Klhl14	UTSW	18	21651994	missense	probably benign	0.30
R5951:Klhl14	UTSW	18	21651620	missense	probably damaging	0.97
R5958:Klhl14	UTSW	18	21565535	missense	probably damaging	0.99
R7231:Klhl14	UTSW	18	21652136	missense	probably damaging	0.99
R7519:Klhl14	UTSW	18	21651843	missense	probably benign	0.36
R7527:Klhl14	UTSW	18	21651540	missense	probably damaging	0.99
R7573:Klhl14	UTSW	18	21652154	missense	probably benign	0.00
R7664:Klhl14	UTSW	18	21554649	missense	probably damaging	1.00
R7737:Klhl14	UTSW	18	21558134	nonsense	probably null
T0722:Klhl14	UTSW	18	21558135	missense	probably damaging	1.00
X0026:Klhl14	UTSW	18	21651941	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- GATGTCACTGGGTGATCAGG -3'
(R):5'- GTGCTAATGGTTCCCAGTTTCAC -3'

Sequencing Primer
(F):5'- TGTCACTGGGTGATCAGGAAAGG -3'
(R):5'- GCTAATGGTTCCCAGTTTCACTAATG -3'

Posted On

2016-11-21