Incidental Mutation 'R5758:Uckl1'
ID445129
Institutional Source Beutler Lab
Gene Symbol Uckl1
Ensembl Gene ENSMUSG00000089917
Gene Nameuridine-cytidine kinase 1-like 1
SynonymsUrkl1, 1110007H10Rik
MMRRC Submission 043203-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.227) question?
Stock #R5758 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location181569149-181584892 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 181569953 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 420 (G420C)
Ref Sequence ENSEMBL: ENSMUSP00000050398 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057816] [ENSMUST00000129469] [ENSMUST00000131949] [ENSMUST00000136875] [ENSMUST00000154613]
Predicted Effect probably damaging
Transcript: ENSMUST00000057816
AA Change: G420C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000050398
Gene: ENSMUSG00000089917
AA Change: G420C

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
Pfam:CPT 98 249 7e-10 PFAM
Pfam:PRK 100 288 5.7e-61 PFAM
Pfam:UPRTase 326 532 2.6e-74 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124315
Predicted Effect probably benign
Transcript: ENSMUST00000129469
SMART Domains Protein: ENSMUSP00000121607
Gene: ENSMUSG00000089917

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
Pfam:CPT 98 210 5.1e-10 PFAM
Pfam:AAA_17 100 251 1.1e-8 PFAM
Pfam:PRK 100 288 3.4e-60 PFAM
Pfam:AAA_18 101 257 5.8e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130893
Predicted Effect probably benign
Transcript: ENSMUST00000131949
Predicted Effect unknown
Transcript: ENSMUST00000134340
AA Change: G74C
SMART Domains Protein: ENSMUSP00000122098
Gene: ENSMUSG00000089917
AA Change: G74C

DomainStartEndE-ValueType
Pfam:UPRTase 1 182 9.8e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136875
SMART Domains Protein: ENSMUSP00000114821
Gene: ENSMUSG00000089917

DomainStartEndE-ValueType
Pfam:CPT 83 211 2.3e-10 PFAM
Pfam:AAA_17 85 235 4.9e-9 PFAM
Pfam:PRK 85 235 8.4e-47 PFAM
Pfam:AAA_18 86 235 2.7e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136997
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138408
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142296
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142491
Predicted Effect probably benign
Transcript: ENSMUST00000144856
SMART Domains Protein: ENSMUSP00000114982
Gene: ENSMUSG00000089917

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
Pfam:CPT 83 211 2.7e-10 PFAM
Pfam:PRK 85 253 7.7e-56 PFAM
Pfam:AAA_17 86 240 2.5e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146823
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149332
Predicted Effect probably benign
Transcript: ENSMUST00000154613
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155182
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156308
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156998
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a uridine kinase. Uridine kinases catalyze the phosphorylation of uridine to uridine monophosphate. This protein has been shown to bind to Epstein-Barr nuclear antigen 3 as well as natural killer lytic-associated molecule. Ubiquitination of this protein is enhanced by the presence of natural killer lytic-associated molecule. In addition, protein levels decrease in the presence of natural killer lytic-associated molecule, suggesting that association with natural killer lytic-associated molecule results in ubiquitination and subsequent degradation of this protein. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,314,536 N2973D probably damaging Het
Acan A T 7: 79,101,214 E1911V possibly damaging Het
Adamts20 T C 15: 94,394,650 N193S probably benign Het
AF067063 T C 13: 119,828,255 D135G probably damaging Het
Arhgap28 T C 17: 67,873,159 D81G probably benign Het
Calhm3 A G 19: 47,151,751 V301A probably damaging Het
Celsr1 C T 15: 85,941,264 G1556D probably benign Het
Cfap221 A G 1: 119,934,558 L598P probably benign Het
Col6a6 T C 9: 105,761,518 probably null Het
Dmxl2 T A 9: 54,472,964 I142F probably benign Het
Dpy19l4 C T 4: 11,276,886 V338M probably damaging Het
Dpys A C 15: 39,826,999 D319E possibly damaging Het
Dsc3 A G 18: 19,989,534 V111A probably damaging Het
Galnt5 T C 2: 57,998,430 V14A probably benign Het
Hebp2 C A 10: 18,544,407 V93L probably damaging Het
Igkv8-21 A T 6: 70,315,025 S78T possibly damaging Het
Jak2 T A 19: 29,309,643 D1036E probably damaging Het
Kazn A G 4: 142,141,671 probably null Het
Kif9 T C 9: 110,489,879 V143A probably damaging Het
Lhcgr T C 17: 88,742,548 I517V probably damaging Het
Llgl1 T C 11: 60,708,567 F458S probably damaging Het
Mrgprb3 C A 7: 48,643,319 M161I probably benign Het
Muc5b A T 7: 141,858,983 I1889F unknown Het
Mysm1 A G 4: 94,952,361 V606A probably damaging Het
Nipal3 T C 4: 135,452,563 D348G probably benign Het
Olfml2b G A 1: 170,669,264 probably null Het
Olfr467 T C 7: 107,814,815 V77A probably damaging Het
Olfr497 T A 7: 108,423,162 V197D probably benign Het
Orc5 T C 5: 22,529,258 D176G possibly damaging Het
Rapgef6 A G 11: 54,668,644 N1041S probably damaging Het
Ryr3 G A 2: 112,841,975 R1384C probably damaging Het
Sar1a A G 10: 61,685,072 Y22C probably benign Het
Shcbp1 T C 8: 4,749,355 probably null Het
Smim17 C T 7: 6,424,789 H25Y possibly damaging Het
Trim10 C T 17: 36,877,152 T420I possibly damaging Het
Trip13 G T 13: 73,937,495 S29R probably benign Het
Tubgcp5 C T 7: 55,818,895 R713C probably damaging Het
Vangl1 A T 3: 102,184,092 V226D probably damaging Het
Zdhhc17 A G 10: 110,944,395 *633Q probably null Het
Zfhx4 A G 3: 5,402,620 K2613E probably damaging Het
Zfp236 G A 18: 82,671,709 T215M probably damaging Het
Zfp563 A G 17: 33,104,920 H163R probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Uckl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00969:Uckl1 APN 2 181569617 missense probably benign 0.09
IGL01128:Uckl1 APN 2 181570337 missense probably damaging 1.00
IGL01325:Uckl1 APN 2 181574961 nonsense probably null
IGL01767:Uckl1 APN 2 181569534 missense probably damaging 1.00
IGL02260:Uckl1 APN 2 181569588 missense probably damaging 1.00
IGL02390:Uckl1 APN 2 181574419 missense possibly damaging 0.59
IGL03369:Uckl1 APN 2 181570189 missense probably benign 0.00
R0001:Uckl1 UTSW 2 181574655 missense probably damaging 1.00
R0528:Uckl1 UTSW 2 181570490 splice site probably benign
R1037:Uckl1 UTSW 2 181572485 missense possibly damaging 0.67
R1355:Uckl1 UTSW 2 181573376 missense probably damaging 1.00
R1416:Uckl1 UTSW 2 181569569 missense possibly damaging 0.79
R1435:Uckl1 UTSW 2 181573133 missense probably benign 0.01
R1676:Uckl1 UTSW 2 181574918 missense probably damaging 1.00
R1723:Uckl1 UTSW 2 181570600 critical splice acceptor site probably null
R1954:Uckl1 UTSW 2 181570527 missense probably benign 0.17
R1955:Uckl1 UTSW 2 181570527 missense probably benign 0.17
R3972:Uckl1 UTSW 2 181574463 missense probably damaging 0.98
R4664:Uckl1 UTSW 2 181574868 missense possibly damaging 0.91
R4666:Uckl1 UTSW 2 181574868 missense possibly damaging 0.91
R5306:Uckl1 UTSW 2 181574367 critical splice donor site probably null
R5751:Uckl1 UTSW 2 181574452 missense possibly damaging 0.81
R6174:Uckl1 UTSW 2 181573073 critical splice donor site probably null
R6662:Uckl1 UTSW 2 181573260 missense possibly damaging 0.87
R6865:Uckl1 UTSW 2 181574493 missense probably damaging 1.00
R7051:Uckl1 UTSW 2 181574244 missense probably damaging 1.00
R7643:Uckl1 UTSW 2 181573106 missense probably benign 0.08
R7818:Uckl1 UTSW 2 181574667 missense probably damaging 0.97
RF014:Uckl1 UTSW 2 181570194 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGTCATCACTGATATCCTTGG -3'
(R):5'- TACGTGGGAAAGTGCTACGC -3'

Sequencing Primer
(F):5'- ACTGATATCCTTGGGAAGCCTCAG -3'
(R):5'- CAGGTGCACATGGCTAGG -3'
Posted On2016-11-21