Mutagenetix > Incidental Mutations

Incidental Mutation 'R5758:Vangl1'

445132

Institutional Source

Beutler Lab

Gene Symbol

Vangl1

Ensembl Gene

ENSMUSG00000027860

Gene Name

VANGL planar cell polarity 1

Synonyms

mStbm, stbm, Lpp2, KITENIN

MMRRC Submission

043203-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.301) question?

Stock #

R5758 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

102153583-102204693 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 102184092 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 226 (V226D)

Ref Sequence

ENSEMBL: ENSMUSP00000126254 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029453] [ENSMUST00000159388] [ENSMUST00000159586] [ENSMUST00000168312]

Predicted Effect

probably damaging
Transcript: ENSMUST00000029453
AA Change: V226D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000029453
Gene: ENSMUSG00000027860
AA Change: V226D

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
Pfam:Strabismus	23	360	3.4e-171	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000159388
AA Change: V226D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000125043
Gene: ENSMUSG00000027860
AA Change: V226D

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
Pfam:Strabismus	25	526	8.6e-262	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000159586

SMART Domains

Protein: ENSMUSP00000124874
Gene: ENSMUSG00000027860

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
Pfam:Strabismus	23	137	3.5e-41	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000168312
AA Change: V226D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000126254
Gene: ENSMUSG00000027860
AA Change: V226D

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
Pfam:Strabismus	23	357	1.2e-170	PFAM
Pfam:Strabismus	354	476	9.5e-67	PFAM

Coding Region Coverage

1x: 99.5%
3x: 98.8%
10x: 97.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tretraspanin family. The encoded protein may be involved in mediating intestinal trefoil factor induced wound healing in the intestinal mucosa. Mutations in this gene are associated with neural tube defects. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a gene trapped allele display abnormal orientation of cochlear hair cell stereociliary bundles but do not develop neural tube or cardiac outflow tract abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	A	G	11: 9,314,536	N2973D	probably damaging	Het
Acan	A	T	7: 79,101,214	E1911V	possibly damaging	Het
Adamts20	T	C	15: 94,394,650	N193S	probably benign	Het
AF067063	T	C	13: 119,828,255	D135G	probably damaging	Het
Arhgap28	T	C	17: 67,873,159	D81G	probably benign	Het
Calhm3	A	G	19: 47,151,751	V301A	probably damaging	Het
Celsr1	C	T	15: 85,941,264	G1556D	probably benign	Het
Cfap221	A	G	1: 119,934,558	L598P	probably benign	Het
Col6a6	T	C	9: 105,761,518		probably null	Het
Dmxl2	T	A	9: 54,472,964	I142F	probably benign	Het
Dpy19l4	C	T	4: 11,276,886	V338M	probably damaging	Het
Dpys	A	C	15: 39,826,999	D319E	possibly damaging	Het
Dsc3	A	G	18: 19,989,534	V111A	probably damaging	Het
Galnt5	T	C	2: 57,998,430	V14A	probably benign	Het
Hebp2	C	A	10: 18,544,407	V93L	probably damaging	Het
Igkv8-21	A	T	6: 70,315,025	S78T	possibly damaging	Het
Jak2	T	A	19: 29,309,643	D1036E	probably damaging	Het
Kazn	A	G	4: 142,141,671		probably null	Het
Kif9	T	C	9: 110,489,879	V143A	probably damaging	Het
Lhcgr	T	C	17: 88,742,548	I517V	probably damaging	Het
Llgl1	T	C	11: 60,708,567	F458S	probably damaging	Het
Mrgprb3	C	A	7: 48,643,319	M161I	probably benign	Het
Muc5b	A	T	7: 141,858,983	I1889F	unknown	Het
Mysm1	A	G	4: 94,952,361	V606A	probably damaging	Het
Nipal3	T	C	4: 135,452,563	D348G	probably benign	Het
Olfml2b	G	A	1: 170,669,264		probably null	Het
Olfr467	T	C	7: 107,814,815	V77A	probably damaging	Het
Olfr497	T	A	7: 108,423,162	V197D	probably benign	Het
Orc5	T	C	5: 22,529,258	D176G	possibly damaging	Het
Rapgef6	A	G	11: 54,668,644	N1041S	probably damaging	Het
Ryr3	G	A	2: 112,841,975	R1384C	probably damaging	Het
Sar1a	A	G	10: 61,685,072	Y22C	probably benign	Het
Shcbp1	T	C	8: 4,749,355		probably null	Het
Smim17	C	T	7: 6,424,789	H25Y	possibly damaging	Het
Trim10	C	T	17: 36,877,152	T420I	possibly damaging	Het
Trip13	G	T	13: 73,937,495	S29R	probably benign	Het
Tubgcp5	C	T	7: 55,818,895	R713C	probably damaging	Het
Uckl1	C	A	2: 181,569,953	G420C	probably damaging	Het
Zdhhc17	A	G	10: 110,944,395	*633Q	probably null	Het
Zfhx4	A	G	3: 5,402,620	K2613E	probably damaging	Het
Zfp236	G	A	18: 82,671,709	T215M	probably damaging	Het
Zfp563	A	G	17: 33,104,920	H163R	probably damaging	Het
Zfp703	C	T	8: 26,979,205	P299L	probably damaging	Het

Other mutations in Vangl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00640:Vangl1	APN	3	102158229	utr 3 prime	probably benign
IGL00870:Vangl1	APN	3	102189440	missense	probably damaging	1.00
IGL01533:Vangl1	APN	3	102163351	missense	possibly damaging	0.88
IGL01981:Vangl1	APN	3	102184291	missense	probably damaging	1.00
IGL02792:Vangl1	APN	3	102163423	missense	probably damaging	0.98
IGL02800:Vangl1	APN	3	102163295	splice site	probably benign
IGL02942:Vangl1	APN	3	102184031	missense	probably damaging	1.00
IGL03029:Vangl1	APN	3	102184084	missense	probably damaging	1.00
R0600:Vangl1	UTSW	3	102166937	missense	probably damaging	1.00
R0904:Vangl1	UTSW	3	102183994	missense	probably damaging	0.99
R1230:Vangl1	UTSW	3	102158293	missense	probably benign	0.00
R1829:Vangl1	UTSW	3	102163466	missense	probably benign
R2005:Vangl1	UTSW	3	102163466	missense	probably benign
R2268:Vangl1	UTSW	3	102196844	missense	probably damaging	1.00
R4181:Vangl1	UTSW	3	102165781	intron	probably benign
R4662:Vangl1	UTSW	3	102166922	missense	probably benign	0.00
R4724:Vangl1	UTSW	3	102184554	missense	probably damaging	1.00
R4755:Vangl1	UTSW	3	102158292	missense	probably benign	0.19
R5548:Vangl1	UTSW	3	102184446	missense	possibly damaging	0.76
R5740:Vangl1	UTSW	3	102184134	missense	probably damaging	0.99
R6150:Vangl1	UTSW	3	102184519	missense	probably damaging	1.00
R6373:Vangl1	UTSW	3	102158448	missense	probably benign
R6943:Vangl1	UTSW	3	102165781	intron	probably benign
R7474:Vangl1	UTSW	3	102184249	missense	probably benign	0.22
R7616:Vangl1	UTSW	3	102184065	missense	probably damaging	1.00
R8120:Vangl1	UTSW	3	102163442	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGCTTACTCCGTGTGCATG -3'
(R):5'- GCCATTTGTGAGGGACTTCTC -3'

Sequencing Primer
(F):5'- GCATGCCCCTTACCTCAAGTG -3'
(R):5'- ATTCTGCTCATCGGAACCTGGG -3'

Posted On

2016-11-21