Incidental Mutation 'R5758:Vangl1'
ID445132
Institutional Source Beutler Lab
Gene Symbol Vangl1
Ensembl Gene ENSMUSG00000027860
Gene NameVANGL planar cell polarity 1
SynonymsmStbm, stbm, Lpp2, KITENIN
MMRRC Submission 043203-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.301) question?
Stock #R5758 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location102153583-102204693 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 102184092 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 226 (V226D)
Ref Sequence ENSEMBL: ENSMUSP00000126254 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029453] [ENSMUST00000159388] [ENSMUST00000159586] [ENSMUST00000168312]
Predicted Effect probably damaging
Transcript: ENSMUST00000029453
AA Change: V226D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029453
Gene: ENSMUSG00000027860
AA Change: V226D

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
Pfam:Strabismus 23 360 3.4e-171 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159388
AA Change: V226D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125043
Gene: ENSMUSG00000027860
AA Change: V226D

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
Pfam:Strabismus 25 526 8.6e-262 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159586
SMART Domains Protein: ENSMUSP00000124874
Gene: ENSMUSG00000027860

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
Pfam:Strabismus 23 137 3.5e-41 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000168312
AA Change: V226D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126254
Gene: ENSMUSG00000027860
AA Change: V226D

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
Pfam:Strabismus 23 357 1.2e-170 PFAM
Pfam:Strabismus 354 476 9.5e-67 PFAM
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tretraspanin family. The encoded protein may be involved in mediating intestinal trefoil factor induced wound healing in the intestinal mucosa. Mutations in this gene are associated with neural tube defects. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a gene trapped allele display abnormal orientation of cochlear hair cell stereociliary bundles but do not develop neural tube or cardiac outflow tract abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,314,536 N2973D probably damaging Het
Acan A T 7: 79,101,214 E1911V possibly damaging Het
Adamts20 T C 15: 94,394,650 N193S probably benign Het
AF067063 T C 13: 119,828,255 D135G probably damaging Het
Arhgap28 T C 17: 67,873,159 D81G probably benign Het
Calhm3 A G 19: 47,151,751 V301A probably damaging Het
Celsr1 C T 15: 85,941,264 G1556D probably benign Het
Cfap221 A G 1: 119,934,558 L598P probably benign Het
Col6a6 T C 9: 105,761,518 probably null Het
Dmxl2 T A 9: 54,472,964 I142F probably benign Het
Dpy19l4 C T 4: 11,276,886 V338M probably damaging Het
Dpys A C 15: 39,826,999 D319E possibly damaging Het
Dsc3 A G 18: 19,989,534 V111A probably damaging Het
Galnt5 T C 2: 57,998,430 V14A probably benign Het
Hebp2 C A 10: 18,544,407 V93L probably damaging Het
Igkv8-21 A T 6: 70,315,025 S78T possibly damaging Het
Jak2 T A 19: 29,309,643 D1036E probably damaging Het
Kazn A G 4: 142,141,671 probably null Het
Kif9 T C 9: 110,489,879 V143A probably damaging Het
Lhcgr T C 17: 88,742,548 I517V probably damaging Het
Llgl1 T C 11: 60,708,567 F458S probably damaging Het
Mrgprb3 C A 7: 48,643,319 M161I probably benign Het
Muc5b A T 7: 141,858,983 I1889F unknown Het
Mysm1 A G 4: 94,952,361 V606A probably damaging Het
Nipal3 T C 4: 135,452,563 D348G probably benign Het
Olfml2b G A 1: 170,669,264 probably null Het
Olfr467 T C 7: 107,814,815 V77A probably damaging Het
Olfr497 T A 7: 108,423,162 V197D probably benign Het
Orc5 T C 5: 22,529,258 D176G possibly damaging Het
Rapgef6 A G 11: 54,668,644 N1041S probably damaging Het
Ryr3 G A 2: 112,841,975 R1384C probably damaging Het
Sar1a A G 10: 61,685,072 Y22C probably benign Het
Shcbp1 T C 8: 4,749,355 probably null Het
Smim17 C T 7: 6,424,789 H25Y possibly damaging Het
Trim10 C T 17: 36,877,152 T420I possibly damaging Het
Trip13 G T 13: 73,937,495 S29R probably benign Het
Tubgcp5 C T 7: 55,818,895 R713C probably damaging Het
Uckl1 C A 2: 181,569,953 G420C probably damaging Het
Zdhhc17 A G 10: 110,944,395 *633Q probably null Het
Zfhx4 A G 3: 5,402,620 K2613E probably damaging Het
Zfp236 G A 18: 82,671,709 T215M probably damaging Het
Zfp563 A G 17: 33,104,920 H163R probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Vangl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00640:Vangl1 APN 3 102158229 utr 3 prime probably benign
IGL00870:Vangl1 APN 3 102189440 missense probably damaging 1.00
IGL01533:Vangl1 APN 3 102163351 missense possibly damaging 0.88
IGL01981:Vangl1 APN 3 102184291 missense probably damaging 1.00
IGL02792:Vangl1 APN 3 102163423 missense probably damaging 0.98
IGL02800:Vangl1 APN 3 102163295 splice site probably benign
IGL02942:Vangl1 APN 3 102184031 missense probably damaging 1.00
IGL03029:Vangl1 APN 3 102184084 missense probably damaging 1.00
R0600:Vangl1 UTSW 3 102166937 missense probably damaging 1.00
R0904:Vangl1 UTSW 3 102183994 missense probably damaging 0.99
R1230:Vangl1 UTSW 3 102158293 missense probably benign 0.00
R1829:Vangl1 UTSW 3 102163466 missense probably benign
R2005:Vangl1 UTSW 3 102163466 missense probably benign
R2268:Vangl1 UTSW 3 102196844 missense probably damaging 1.00
R4181:Vangl1 UTSW 3 102165781 intron probably benign
R4662:Vangl1 UTSW 3 102166922 missense probably benign 0.00
R4724:Vangl1 UTSW 3 102184554 missense probably damaging 1.00
R4755:Vangl1 UTSW 3 102158292 missense probably benign 0.19
R5548:Vangl1 UTSW 3 102184446 missense possibly damaging 0.76
R5740:Vangl1 UTSW 3 102184134 missense probably damaging 0.99
R6150:Vangl1 UTSW 3 102184519 missense probably damaging 1.00
R6373:Vangl1 UTSW 3 102158448 missense probably benign
R6943:Vangl1 UTSW 3 102165781 intron probably benign
R7474:Vangl1 UTSW 3 102184249 missense probably benign 0.22
R7616:Vangl1 UTSW 3 102184065 missense probably damaging 1.00
R8120:Vangl1 UTSW 3 102163442 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCTTACTCCGTGTGCATG -3'
(R):5'- GCCATTTGTGAGGGACTTCTC -3'

Sequencing Primer
(F):5'- GCATGCCCCTTACCTCAAGTG -3'
(R):5'- ATTCTGCTCATCGGAACCTGGG -3'
Posted On2016-11-21