Incidental Mutation 'R5758:Mrgprb3'
ID445139
Institutional Source Beutler Lab
Gene Symbol Mrgprb3
Ensembl Gene ENSMUSG00000070546
Gene NameMAS-related GPR, member B3
SynonymsMrgB3
MMRRC Submission 043203-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R5758 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location48642803-48643811 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 48643319 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 161 (M161I)
Ref Sequence ENSEMBL: ENSMUSP00000091945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094383]
Predicted Effect probably benign
Transcript: ENSMUST00000094383
AA Change: M161I

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000091945
Gene: ENSMUSG00000070546
AA Change: M161I

DomainStartEndE-ValueType
SCOP:d1l9ha_ 25 279 4e-13 SMART
low complexity region 301 312 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,314,536 N2973D probably damaging Het
Acan A T 7: 79,101,214 E1911V possibly damaging Het
Adamts20 T C 15: 94,394,650 N193S probably benign Het
AF067063 T C 13: 119,828,255 D135G probably damaging Het
Arhgap28 T C 17: 67,873,159 D81G probably benign Het
Calhm3 A G 19: 47,151,751 V301A probably damaging Het
Celsr1 C T 15: 85,941,264 G1556D probably benign Het
Cfap221 A G 1: 119,934,558 L598P probably benign Het
Col6a6 T C 9: 105,761,518 probably null Het
Dmxl2 T A 9: 54,472,964 I142F probably benign Het
Dpy19l4 C T 4: 11,276,886 V338M probably damaging Het
Dpys A C 15: 39,826,999 D319E possibly damaging Het
Dsc3 A G 18: 19,989,534 V111A probably damaging Het
Galnt5 T C 2: 57,998,430 V14A probably benign Het
Hebp2 C A 10: 18,544,407 V93L probably damaging Het
Igkv8-21 A T 6: 70,315,025 S78T possibly damaging Het
Jak2 T A 19: 29,309,643 D1036E probably damaging Het
Kazn A G 4: 142,141,671 probably null Het
Kif9 T C 9: 110,489,879 V143A probably damaging Het
Lhcgr T C 17: 88,742,548 I517V probably damaging Het
Llgl1 T C 11: 60,708,567 F458S probably damaging Het
Muc5b A T 7: 141,858,983 I1889F unknown Het
Mysm1 A G 4: 94,952,361 V606A probably damaging Het
Nipal3 T C 4: 135,452,563 D348G probably benign Het
Olfml2b G A 1: 170,669,264 probably null Het
Olfr467 T C 7: 107,814,815 V77A probably damaging Het
Olfr497 T A 7: 108,423,162 V197D probably benign Het
Orc5 T C 5: 22,529,258 D176G possibly damaging Het
Rapgef6 A G 11: 54,668,644 N1041S probably damaging Het
Ryr3 G A 2: 112,841,975 R1384C probably damaging Het
Sar1a A G 10: 61,685,072 Y22C probably benign Het
Shcbp1 T C 8: 4,749,355 probably null Het
Smim17 C T 7: 6,424,789 H25Y possibly damaging Het
Trim10 C T 17: 36,877,152 T420I possibly damaging Het
Trip13 G T 13: 73,937,495 S29R probably benign Het
Tubgcp5 C T 7: 55,818,895 R713C probably damaging Het
Uckl1 C A 2: 181,569,953 G420C probably damaging Het
Vangl1 A T 3: 102,184,092 V226D probably damaging Het
Zdhhc17 A G 10: 110,944,395 *633Q probably null Het
Zfhx4 A G 3: 5,402,620 K2613E probably damaging Het
Zfp236 G A 18: 82,671,709 T215M probably damaging Het
Zfp563 A G 17: 33,104,920 H163R probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Mrgprb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03069:Mrgprb3 APN 7 48643450 missense possibly damaging 0.71
Reserve UTSW 7 48643699 missense probably benign 0.02
starker UTSW 7 48643368 missense probably benign 0.28
IGL03052:Mrgprb3 UTSW 7 48643593 missense possibly damaging 0.93
R0446:Mrgprb3 UTSW 7 48643236 missense probably benign 0.42
R0546:Mrgprb3 UTSW 7 48643515 missense probably damaging 1.00
R0885:Mrgprb3 UTSW 7 48643096 missense probably damaging 1.00
R1764:Mrgprb3 UTSW 7 48643023 missense probably benign 0.01
R2044:Mrgprb3 UTSW 7 48643734 missense possibly damaging 0.92
R2230:Mrgprb3 UTSW 7 48643022 missense probably benign 0.05
R2232:Mrgprb3 UTSW 7 48643022 missense probably benign 0.05
R2240:Mrgprb3 UTSW 7 48643641 missense probably damaging 0.99
R3001:Mrgprb3 UTSW 7 48643484 missense probably benign
R3002:Mrgprb3 UTSW 7 48643484 missense probably benign
R4717:Mrgprb3 UTSW 7 48643252 missense probably benign 0.01
R4805:Mrgprb3 UTSW 7 48643306 missense probably benign 0.01
R5083:Mrgprb3 UTSW 7 48643014 missense probably benign 0.01
R5311:Mrgprb3 UTSW 7 48643311 missense probably damaging 1.00
R5330:Mrgprb3 UTSW 7 48642934 missense possibly damaging 0.90
R5331:Mrgprb3 UTSW 7 48642934 missense possibly damaging 0.90
R5615:Mrgprb3 UTSW 7 48643486 missense probably benign 0.01
R5621:Mrgprb3 UTSW 7 48643368 missense probably benign 0.28
R5697:Mrgprb3 UTSW 7 48642925 missense probably damaging 0.96
R5725:Mrgprb3 UTSW 7 48643800 start codon destroyed probably null 0.02
R5807:Mrgprb3 UTSW 7 48643362 missense probably benign 0.02
R5908:Mrgprb3 UTSW 7 48643618 missense probably damaging 0.98
R6902:Mrgprb3 UTSW 7 48643699 missense probably benign 0.02
R7037:Mrgprb3 UTSW 7 48643194 missense probably damaging 1.00
R7288:Mrgprb3 UTSW 7 48643311 missense probably damaging 1.00
R7605:Mrgprb3 UTSW 7 48643114 missense probably benign 0.01
R8246:Mrgprb3 UTSW 7 48643520 missense probably benign 0.02
R8292:Mrgprb3 UTSW 7 48643507 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCAGGAGGAGTAGCACTCTGAG -3'
(R):5'- CATTAGACAGCTTTTGGATACTGTG -3'

Sequencing Primer
(F):5'- GAGTGCAATAGTTACATTCAGCCTGG -3'
(R):5'- GACAGCTTTTGGATACTGTGACAATG -3'
Posted On2016-11-21