Incidental Mutation 'R0027:Olfr214'
ID44515
Institutional Source Beutler Lab
Gene Symbol Olfr214
Ensembl Gene ENSMUSG00000051046
Gene Nameolfactory receptor 214
SynonymsMOR119-1, GA_x54KRFPKN04-58190962-58191900
MMRRC Submission 038322-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.210) question?
Stock #R0027 (G1) of strain 730
Quality Score225
Status Validated (trace)
Chromosome6
Chromosomal Location116554235-116560611 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 116556949 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 175 (S175P)
Ref Sequence ENSEMBL: ENSMUSP00000150737 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060204] [ENSMUST00000122096] [ENSMUST00000203867] [ENSMUST00000214699] [ENSMUST00000215846] [ENSMUST00000217313]
Predicted Effect probably damaging
Transcript: ENSMUST00000060204
AA Change: S175P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000052730
Gene: ENSMUSG00000051046
AA Change: S175P

DomainStartEndE-ValueType
Pfam:7tm_4 39 316 4.7e-47 PFAM
Pfam:7tm_1 49 298 5.9e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122096
SMART Domains Protein: ENSMUSP00000145194
Gene: ENSMUSG00000107906

DomainStartEndE-ValueType
DEXDc 57 254 2.4e-59 SMART
HELICc 291 372 6.6e-38 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000203867
AA Change: S175P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000145465
Gene: ENSMUSG00000051046
AA Change: S175P

DomainStartEndE-ValueType
Pfam:7tm_4 39 316 4.7e-47 PFAM
Pfam:7tm_1 49 298 5.9e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214699
AA Change: S175P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000215846
AA Change: S175P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000217313
AA Change: S175P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts12 A T 15: 11,285,873 I723F probably damaging Het
Anapc1 G T 2: 128,641,511 D1221E possibly damaging Het
Arhgef28 T A 13: 97,945,696 E1201V possibly damaging Het
Capn12 T A 7: 28,881,960 H79Q probably benign Het
Caprin1 A T 2: 103,775,580 probably benign Het
Carmil3 T A 14: 55,494,403 F196Y probably damaging Het
Casp8ap2 A G 4: 32,643,810 H961R probably benign Het
Cdkl3 C T 11: 52,032,349 probably benign Het
Cic T A 7: 25,287,140 S1299T probably damaging Het
Cic C A 7: 25,287,141 S1299Y probably damaging Het
Col13a1 A G 10: 61,850,161 L684P unknown Het
D10Wsu102e G A 10: 83,364,529 probably benign Het
D430041D05Rik A T 2: 104,255,044 F1053L probably benign Het
Dab1 T C 4: 104,704,199 probably benign Het
Dmxl1 A T 18: 49,957,295 probably benign Het
Dst C T 1: 34,189,119 P1606L probably damaging Het
E130309D02Rik G A 5: 143,308,062 T220I probably damaging Het
Eml1 T C 12: 108,536,298 C708R possibly damaging Het
Fam131b T A 6: 42,318,248 M304L probably benign Het
Foxk1 A T 5: 142,450,340 I321F probably damaging Het
Gm10306 C T 4: 94,556,790 probably benign Het
Gm10985 TA TANA 3: 53,845,256 probably null Het
Gse1 T C 8: 120,566,546 probably benign Het
Hcn3 A G 3: 89,159,825 S79P probably damaging Het
Hspa4 T A 11: 53,283,585 M203L probably benign Het
Kctd7 G A 5: 130,152,573 R279H probably damaging Het
Kif11 C T 19: 37,406,983 probably benign Het
Klf13 T C 7: 63,891,761 N206S probably benign Het
Kpna7 A T 5: 144,989,697 Y482N probably damaging Het
Lamc1 T C 1: 153,262,583 Y175C probably damaging Het
Lrpprc G A 17: 84,767,007 R491* probably null Het
Madd T A 2: 91,152,549 I1350F probably damaging Het
Mbtd1 T C 11: 93,924,549 V321A possibly damaging Het
Mon2 G A 10: 123,036,048 S357L possibly damaging Het
Ndst3 A G 3: 123,671,513 V270A probably damaging Het
Nlrp2 T C 7: 5,322,448 T742A probably damaging Het
Papola A C 12: 105,833,136 S675R probably benign Het
Pcdh9 T A 14: 93,888,645 I30F probably null Het
Prl6a1 T A 13: 27,318,028 L126Q probably damaging Het
Prr29 A G 11: 106,376,276 E89G possibly damaging Het
Psmd1 T C 1: 86,094,265 probably benign Het
Rad9b A G 5: 122,351,723 probably benign Het
Rest T C 5: 77,282,551 V939A probably benign Het
Rnf135 T A 11: 80,193,942 S180R probably benign Het
Sarm1 C A 11: 78,488,091 R376L probably damaging Het
Scap C A 9: 110,379,730 P613Q probably benign Het
Scube3 C T 17: 28,164,357 R374* probably null Het
Setx T G 2: 29,139,221 V167G probably damaging Het
Snrnp40 T A 4: 130,368,273 H151Q probably damaging Het
Sox21 G T 14: 118,235,617 H7N probably benign Het
Stard9 A T 2: 120,703,501 Q3413L probably benign Het
Sycp1 A G 3: 102,895,910 V528A probably benign Het
Tcl1b3 A T 12: 105,191,239 S47C probably damaging Het
Treml4 T C 17: 48,264,934 S122P possibly damaging Het
Trip11 C T 12: 101,885,169 A879T probably benign Het
Ubr4 C A 4: 139,400,393 N567K probably damaging Het
Zan T C 5: 137,406,519 probably benign Het
Zfp804a G A 2: 82,257,200 D458N probably damaging Het
Zic2 T C 14: 122,476,343 M223T possibly damaging Het
Other mutations in Olfr214
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00951:Olfr214 APN 6 116557066 missense probably benign
IGL01837:Olfr214 APN 6 116556846 nonsense probably null
IGL02523:Olfr214 APN 6 116557093 missense probably benign 0.03
R0616:Olfr214 UTSW 6 116556928 missense probably benign 0.00
R1121:Olfr214 UTSW 6 116557229 missense probably damaging 0.99
R1555:Olfr214 UTSW 6 116556826 missense probably damaging 1.00
R1691:Olfr214 UTSW 6 116556577 missense probably benign 0.00
R2196:Olfr214 UTSW 6 116556617 missense probably damaging 0.99
R3080:Olfr214 UTSW 6 116557217 missense probably damaging 0.98
R5416:Olfr214 UTSW 6 116557205 missense probably damaging 1.00
R5706:Olfr214 UTSW 6 116557113 missense probably damaging 1.00
R6848:Olfr214 UTSW 6 116556775 missense probably damaging 0.98
R7425:Olfr214 UTSW 6 116556437 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ATGTCCTTGGATCGCTACCTAGCC -3'
(R):5'- GCGTCACTACCGTGTTTACGAGAG -3'

Sequencing Primer
(F):5'- GGATCGCTACCTAGCCATTTG -3'
(R):5'- TGTTTACGAGAGCGGCCTC -3'
Posted On2013-06-11