Incidental Mutation 'R5758:Zdhhc17'
ID445150
Institutional Source Beutler Lab
Gene Symbol Zdhhc17
Ensembl Gene ENSMUSG00000035798
Gene Namezinc finger, DHHC domain containing 17
SynonymsHip14, A230053P19Rik, D130071N24Rik
MMRRC Submission 043203-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5758 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location110941780-111010140 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to G at 110944395 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Glutamine at position 633 (*633Q)
Ref Sequence ENSEMBL: ENSMUSP00000043279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020403] [ENSMUST00000041723]
Predicted Effect probably benign
Transcript: ENSMUST00000020403
SMART Domains Protein: ENSMUSP00000020403
Gene: ENSMUSG00000020186

DomainStartEndE-ValueType
LIM 9 61 3.56e-11 SMART
LIM 118 170 7.39e-18 SMART
Predicted Effect probably null
Transcript: ENSMUST00000041723
AA Change: *633Q
SMART Domains Protein: ENSMUSP00000043279
Gene: ENSMUSG00000035798
AA Change: *633Q

DomainStartEndE-ValueType
Blast:ANK 57 85 2e-8 BLAST
ANK 89 118 6.71e-2 SMART
ANK 123 152 1.99e-4 SMART
ANK 156 185 1.61e-4 SMART
ANK 189 219 1.9e-1 SMART
ANK 224 253 1.53e-5 SMART
Blast:ANK 257 286 2e-11 BLAST
transmembrane domain 305 323 N/A INTRINSIC
transmembrane domain 328 350 N/A INTRINSIC
transmembrane domain 357 379 N/A INTRINSIC
transmembrane domain 384 403 N/A INTRINSIC
Pfam:zf-DHHC 434 570 1e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217698
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217982
Predicted Effect probably benign
Transcript: ENSMUST00000220247
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220301
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reminiscent of Huntington disease (decreased body weight, impaired coordination, hyperactivity, increased rearing, decreased prepulse inhibition, increased stereotypic behavior, reduced striatum, and decreased brain weight). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,314,536 N2973D probably damaging Het
Acan A T 7: 79,101,214 E1911V possibly damaging Het
Adamts20 T C 15: 94,394,650 N193S probably benign Het
AF067063 T C 13: 119,828,255 D135G probably damaging Het
Arhgap28 T C 17: 67,873,159 D81G probably benign Het
Calhm3 A G 19: 47,151,751 V301A probably damaging Het
Celsr1 C T 15: 85,941,264 G1556D probably benign Het
Cfap221 A G 1: 119,934,558 L598P probably benign Het
Col6a6 T C 9: 105,761,518 probably null Het
Dmxl2 T A 9: 54,472,964 I142F probably benign Het
Dpy19l4 C T 4: 11,276,886 V338M probably damaging Het
Dpys A C 15: 39,826,999 D319E possibly damaging Het
Dsc3 A G 18: 19,989,534 V111A probably damaging Het
Galnt5 T C 2: 57,998,430 V14A probably benign Het
Hebp2 C A 10: 18,544,407 V93L probably damaging Het
Igkv8-21 A T 6: 70,315,025 S78T possibly damaging Het
Jak2 T A 19: 29,309,643 D1036E probably damaging Het
Kazn A G 4: 142,141,671 probably null Het
Kif9 T C 9: 110,489,879 V143A probably damaging Het
Lhcgr T C 17: 88,742,548 I517V probably damaging Het
Llgl1 T C 11: 60,708,567 F458S probably damaging Het
Mrgprb3 C A 7: 48,643,319 M161I probably benign Het
Muc5b A T 7: 141,858,983 I1889F unknown Het
Mysm1 A G 4: 94,952,361 V606A probably damaging Het
Nipal3 T C 4: 135,452,563 D348G probably benign Het
Olfml2b G A 1: 170,669,264 probably null Het
Olfr467 T C 7: 107,814,815 V77A probably damaging Het
Olfr497 T A 7: 108,423,162 V197D probably benign Het
Orc5 T C 5: 22,529,258 D176G possibly damaging Het
Rapgef6 A G 11: 54,668,644 N1041S probably damaging Het
Ryr3 G A 2: 112,841,975 R1384C probably damaging Het
Sar1a A G 10: 61,685,072 Y22C probably benign Het
Shcbp1 T C 8: 4,749,355 probably null Het
Smim17 C T 7: 6,424,789 H25Y possibly damaging Het
Trim10 C T 17: 36,877,152 T420I possibly damaging Het
Trip13 G T 13: 73,937,495 S29R probably benign Het
Tubgcp5 C T 7: 55,818,895 R713C probably damaging Het
Uckl1 C A 2: 181,569,953 G420C probably damaging Het
Vangl1 A T 3: 102,184,092 V226D probably damaging Het
Zfhx4 A G 3: 5,402,620 K2613E probably damaging Het
Zfp236 G A 18: 82,671,709 T215M probably damaging Het
Zfp563 A G 17: 33,104,920 H163R probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Zdhhc17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01546:Zdhhc17 APN 10 110946193 missense probably damaging 1.00
IGL01812:Zdhhc17 APN 10 110948217 missense possibly damaging 0.93
IGL01948:Zdhhc17 APN 10 110946276 missense possibly damaging 0.56
IGL02002:Zdhhc17 APN 10 110967689 missense probably benign
IGL03263:Zdhhc17 APN 10 110961016 missense probably damaging 1.00
R0153:Zdhhc17 UTSW 10 110955094 nonsense probably null
R0375:Zdhhc17 UTSW 10 110982106 nonsense probably null
R0436:Zdhhc17 UTSW 10 110981990 splice site probably null
R1452:Zdhhc17 UTSW 10 110955075 missense probably benign 0.04
R1496:Zdhhc17 UTSW 10 110946210 missense probably damaging 0.99
R1528:Zdhhc17 UTSW 10 110948189 critical splice donor site probably null
R1856:Zdhhc17 UTSW 10 110947293 splice site probably null
R2119:Zdhhc17 UTSW 10 110982048 missense possibly damaging 0.92
R3747:Zdhhc17 UTSW 10 110944420 missense probably benign 0.24
R4900:Zdhhc17 UTSW 10 110985958 missense possibly damaging 0.95
R5647:Zdhhc17 UTSW 10 110973833 missense probably damaging 1.00
R6228:Zdhhc17 UTSW 10 110956355 missense probably benign 0.01
R6823:Zdhhc17 UTSW 10 110955111 missense possibly damaging 0.91
R7172:Zdhhc17 UTSW 10 111009948 missense possibly damaging 0.82
R7874:Zdhhc17 UTSW 10 110982117 missense possibly damaging 0.93
Z1088:Zdhhc17 UTSW 10 110945466 splice site probably null
Predicted Primers PCR Primer
(F):5'- GATGATCTTCTCTTCCTAGGCGTG -3'
(R):5'- GTCACTCATACTAACTGAATTCTCC -3'

Sequencing Primer
(F):5'- CTCTTCCTAGGCGTGGCAGTG -3'
(R):5'- AACTGAATTCTCCTTTCTTTTGGGG -3'
Posted On2016-11-21