Incidental Mutation 'R5758:Zfp563'
ID445159
Institutional Source Beutler Lab
Gene Symbol Zfp563
Ensembl Gene ENSMUSG00000067424
Gene Namezinc finger protein 563
Synonymszinc finger protein, Zfp413
MMRRC Submission 043203-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R5758 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location33089310-33106203 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33104920 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 163 (H163R)
Ref Sequence ENSEMBL: ENSMUSP00000118809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000131722] [ENSMUST00000140829]
Predicted Effect probably damaging
Transcript: ENSMUST00000131722
AA Change: H163R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118809
Gene: ENSMUSG00000067424
AA Change: H163R

DomainStartEndE-ValueType
KRAB 4 61 5.45e-16 SMART
ZnF_C2H2 141 163 2.63e2 SMART
ZnF_C2H2 169 191 9.08e-4 SMART
ZnF_C2H2 197 219 9.88e-5 SMART
ZnF_C2H2 225 247 3.16e-3 SMART
ZnF_C2H2 253 275 5.81e-2 SMART
ZnF_C2H2 281 303 2.4e-3 SMART
ZnF_C2H2 309 331 1.82e-3 SMART
ZnF_C2H2 337 359 1.72e-4 SMART
ZnF_C2H2 365 387 4.54e-4 SMART
ZnF_C2H2 393 415 7.78e-3 SMART
ZnF_C2H2 421 443 3.63e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000140829
AA Change: H163R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000121678
Gene: ENSMUSG00000067424
AA Change: H163R

DomainStartEndE-ValueType
KRAB 4 61 5.45e-16 SMART
ZnF_C2H2 141 163 2.63e2 SMART
ZnF_C2H2 169 191 9.08e-4 SMART
Pfam:zf-C2H2_4 197 209 9.4e-2 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153072
SMART Domains Protein: ENSMUSP00000119142
Gene: ENSMUSG00000067424

DomainStartEndE-ValueType
low complexity region 30 41 N/A INTRINSIC
KRAB 45 102 5.45e-16 SMART
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,314,536 N2973D probably damaging Het
Acan A T 7: 79,101,214 E1911V possibly damaging Het
Adamts20 T C 15: 94,394,650 N193S probably benign Het
AF067063 T C 13: 119,828,255 D135G probably damaging Het
Arhgap28 T C 17: 67,873,159 D81G probably benign Het
Calhm3 A G 19: 47,151,751 V301A probably damaging Het
Celsr1 C T 15: 85,941,264 G1556D probably benign Het
Cfap221 A G 1: 119,934,558 L598P probably benign Het
Col6a6 T C 9: 105,761,518 probably null Het
Dmxl2 T A 9: 54,472,964 I142F probably benign Het
Dpy19l4 C T 4: 11,276,886 V338M probably damaging Het
Dpys A C 15: 39,826,999 D319E possibly damaging Het
Dsc3 A G 18: 19,989,534 V111A probably damaging Het
Galnt5 T C 2: 57,998,430 V14A probably benign Het
Hebp2 C A 10: 18,544,407 V93L probably damaging Het
Igkv8-21 A T 6: 70,315,025 S78T possibly damaging Het
Jak2 T A 19: 29,309,643 D1036E probably damaging Het
Kazn A G 4: 142,141,671 probably null Het
Kif9 T C 9: 110,489,879 V143A probably damaging Het
Lhcgr T C 17: 88,742,548 I517V probably damaging Het
Llgl1 T C 11: 60,708,567 F458S probably damaging Het
Mrgprb3 C A 7: 48,643,319 M161I probably benign Het
Muc5b A T 7: 141,858,983 I1889F unknown Het
Mysm1 A G 4: 94,952,361 V606A probably damaging Het
Nipal3 T C 4: 135,452,563 D348G probably benign Het
Olfml2b G A 1: 170,669,264 probably null Het
Olfr467 T C 7: 107,814,815 V77A probably damaging Het
Olfr497 T A 7: 108,423,162 V197D probably benign Het
Orc5 T C 5: 22,529,258 D176G possibly damaging Het
Rapgef6 A G 11: 54,668,644 N1041S probably damaging Het
Ryr3 G A 2: 112,841,975 R1384C probably damaging Het
Sar1a A G 10: 61,685,072 Y22C probably benign Het
Shcbp1 T C 8: 4,749,355 probably null Het
Smim17 C T 7: 6,424,789 H25Y possibly damaging Het
Trim10 C T 17: 36,877,152 T420I possibly damaging Het
Trip13 G T 13: 73,937,495 S29R probably benign Het
Tubgcp5 C T 7: 55,818,895 R713C probably damaging Het
Uckl1 C A 2: 181,569,953 G420C probably damaging Het
Vangl1 A T 3: 102,184,092 V226D probably damaging Het
Zdhhc17 A G 10: 110,944,395 *633Q probably null Het
Zfhx4 A G 3: 5,402,620 K2613E probably damaging Het
Zfp236 G A 18: 82,671,709 T215M probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Zfp563
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01629:Zfp563 APN 17 33104626 missense probably damaging 1.00
IGL01981:Zfp563 APN 17 33105409 missense probably benign 0.16
IGL02407:Zfp563 APN 17 33104821 missense probably benign 0.00
IGL02662:Zfp563 APN 17 33102279 missense probably damaging 1.00
IGL03220:Zfp563 APN 17 33104687 missense probably benign 0.44
R0241:Zfp563 UTSW 17 33104685 missense possibly damaging 0.61
R0241:Zfp563 UTSW 17 33104685 missense possibly damaging 0.61
R0537:Zfp563 UTSW 17 33104685 missense possibly damaging 0.61
R0552:Zfp563 UTSW 17 33104685 missense possibly damaging 0.61
R1544:Zfp563 UTSW 17 33105213 missense probably benign 0.01
R3763:Zfp563 UTSW 17 33104928 nonsense probably null
R3979:Zfp563 UTSW 17 33105727 missense probably benign 0.03
R4938:Zfp563 UTSW 17 33105709 missense probably damaging 1.00
R5280:Zfp563 UTSW 17 33104838 missense probably damaging 0.99
R5383:Zfp563 UTSW 17 33104707 missense probably benign
R5485:Zfp563 UTSW 17 33089566 unclassified probably benign
R5524:Zfp563 UTSW 17 33102541 critical splice acceptor site probably null
R5567:Zfp563 UTSW 17 33089457 unclassified probably benign
R5736:Zfp563 UTSW 17 33104986 missense possibly damaging 0.91
R6034:Zfp563 UTSW 17 33104961 missense probably damaging 0.96
R6034:Zfp563 UTSW 17 33104961 missense probably damaging 0.96
R6532:Zfp563 UTSW 17 33105698 missense probably benign 0.21
RF007:Zfp563 UTSW 17 33105025 missense probably benign
X0023:Zfp563 UTSW 17 33105721 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAACCTCTCATGGAGTAAAACGG -3'
(R):5'- TTACATACAAAGGGTTTCTCTCCG -3'

Sequencing Primer
(F):5'- TCTCATGGAGTAAAACGGTGTGAAAG -3'
(R):5'- CGCTGTGAATCCTGTCATGACG -3'
Posted On2016-11-21