Incidental Mutation 'R5759:Dnah7c'
ID 445170
Institutional Source Beutler Lab
Gene Symbol Dnah7c
Ensembl Gene ENSMUSG00000101337
Gene Name dynein, axonemal, heavy chain 7C
Synonyms Dnahc7c
MMRRC Submission 043361-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.371) question?
Stock # R5759 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 46425592-46807476 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 46615367 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Arginine at position 1436 (G1436R)
Ref Sequence ENSEMBL: ENSMUSP00000140430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178395] [ENSMUST00000189749]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000178395
AA Change: G136R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136771
Gene: ENSMUSG00000101337
AA Change: G136R

DomainStartEndE-ValueType
Pfam:AAA_6 1 204 5.4e-82 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000189749
AA Change: G1436R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140430
Gene: ENSMUSG00000101337
AA Change: G1436R

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 37 48 N/A INTRINSIC
coiled coil region 714 746 N/A INTRINSIC
Pfam:DHC_N2 754 1167 2.2e-138 PFAM
AAA 1320 1459 4e-3 SMART
Blast:AAA 1601 1829 4e-87 BLAST
AAA 1968 2116 8.7e-4 SMART
Pfam:AAA_8 2303 2574 6.2e-73 PFAM
Pfam:MT 2586 2935 5.4e-52 PFAM
Pfam:AAA_9 2953 3183 7.4e-63 PFAM
Pfam:Dynein_heavy 3312 4021 1.3e-250 PFAM
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.8%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,068,658 S1203P probably benign Het
Adamts1 A G 16: 85,798,048 V341A possibly damaging Het
AF529169 A T 9: 89,601,072 N757K probably benign Het
Arf2 G A 11: 103,983,633 G144S probably benign Het
Atr A G 9: 95,874,402 N862D probably benign Het
Cep295nl T C 11: 118,333,646 H124R possibly damaging Het
Chd6 C T 2: 160,983,762 V1141I possibly damaging Het
Chst5 C A 8: 111,890,210 K259N probably benign Het
Dchs1 T A 7: 105,764,176 D1144V probably damaging Het
Dmxl2 T C 9: 54,375,508 Y2795C probably damaging Het
Dnah7b A G 1: 46,277,120 N3131S probably damaging Het
Emp2 T A 16: 10,284,510 Y146F probably damaging Het
Exoc6 C T 19: 37,573,741 Q148* probably null Het
Fam13b T C 18: 34,497,435 D90G probably damaging Het
Fam186b T G 15: 99,279,717 Y576S probably benign Het
Fras1 T C 5: 96,709,916 V2023A probably benign Het
Gm14409 A T 2: 177,264,972 C244* probably null Het
Grm5 A C 7: 88,026,600 M441L probably damaging Het
Hhatl A G 9: 121,788,277 Y297H probably damaging Het
Ifi30 A G 8: 70,766,544 probably benign Het
Ing2 G T 8: 47,669,005 N169K possibly damaging Het
Kat6a T G 8: 22,938,012 S1128A probably benign Het
Madd T C 2: 91,162,075 E1041G possibly damaging Het
Mcm3 CT CTT 1: 20,808,748 probably null Het
Mfsd5 G A 15: 102,281,078 G295D possibly damaging Het
Mmp20 T A 9: 7,628,377 probably null Het
Mybphl T C 3: 108,374,754 V100A probably benign Het
Ndfip2 T A 14: 105,302,316 probably null Het
Olfr862 A G 9: 19,884,188 V39A probably benign Het
Olfr869 T A 9: 20,137,932 V272E probably benign Het
Olfr905 T A 9: 38,473,535 S263T possibly damaging Het
Phf19 T G 2: 34,897,123 D443A probably damaging Het
Piezo1 A G 8: 122,507,655 V84A probably damaging Het
Sept9 A G 11: 117,352,268 I94V probably benign Het
Slc35a1 C A 4: 34,675,032 V132L probably benign Het
Sntg1 G A 1: 8,414,270 S442L probably benign Het
Tcf25 A G 8: 123,381,457 T84A probably benign Het
Tchhl1 C G 3: 93,471,556 S522R probably damaging Het
Tmem106b A G 6: 13,075,042 E76G probably damaging Het
Tnk2 C T 16: 32,680,664 P932S probably benign Het
Trib1 G A 15: 59,654,501 V307I probably benign Het
Trib3 A T 2: 152,343,295 D11E probably benign Het
Trim34b T C 7: 104,331,433 S243P possibly damaging Het
Vmn2r50 A G 7: 10,047,978 I280T probably damaging Het
Zfp445 G T 9: 122,853,146 Q577K probably benign Het
Zfp599 T C 9: 22,249,661 K403E probably damaging Het
Other mutations in Dnah7c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00559:Dnah7c APN 1 46807289 missense possibly damaging 0.72
IGL02958:Dnah7c APN 1 46657111 missense probably damaging 1.00
IGL03035:Dnah7c APN 1 46524117 missense probably benign 0.37
IGL03161:Dnah7c APN 1 46467296 missense probably benign 0.20
IGL03178:Dnah7c APN 1 46467365 missense probably benign
IGL03052:Dnah7c UTSW 1 46632149 missense probably damaging 1.00
R0751:Dnah7c UTSW 1 46465905 missense probably benign
R1029:Dnah7c UTSW 1 46612721 missense probably damaging 1.00
R3104:Dnah7c UTSW 1 46798279 missense probably damaging 0.97
R3977:Dnah7c UTSW 1 46628911 missense possibly damaging 0.75
R4003:Dnah7c UTSW 1 46681817 missense probably damaging 1.00
R4133:Dnah7c UTSW 1 46665990 missense probably benign 0.01
R4303:Dnah7c UTSW 1 46748578 missense probably damaging 1.00
R4329:Dnah7c UTSW 1 46649281 missense probably benign 0.33
R4434:Dnah7c UTSW 1 46666282 missense probably damaging 1.00
R4457:Dnah7c UTSW 1 46740621 missense probably damaging 1.00
R4470:Dnah7c UTSW 1 46748635 missense possibly damaging 0.56
R4507:Dnah7c UTSW 1 46766611 missense probably damaging 1.00
R4527:Dnah7c UTSW 1 46532931 missense probably benign 0.34
R4571:Dnah7c UTSW 1 46533216 missense probably damaging 0.99
R4589:Dnah7c UTSW 1 46514583 nonsense probably null
R4731:Dnah7c UTSW 1 46770173 missense probably damaging 1.00
R4732:Dnah7c UTSW 1 46770173 missense probably damaging 1.00
R4733:Dnah7c UTSW 1 46770173 missense probably damaging 1.00
R4747:Dnah7c UTSW 1 46533168 missense probably damaging 1.00
R4845:Dnah7c UTSW 1 46793532 missense probably damaging 1.00
R4873:Dnah7c UTSW 1 46688925 missense probably benign
R4875:Dnah7c UTSW 1 46688925 missense probably benign
R4916:Dnah7c UTSW 1 46595008 missense probably damaging 1.00
R5241:Dnah7c UTSW 1 46530500 missense probably benign
R5279:Dnah7c UTSW 1 46519269 missense probably benign 0.14
R5327:Dnah7c UTSW 1 46665568 missense probably benign 0.05
R5546:Dnah7c UTSW 1 46666317 missense probably damaging 1.00
R5605:Dnah7c UTSW 1 46798235 missense possibly damaging 0.84
R5637:Dnah7c UTSW 1 46760361 splice site probably null
R5639:Dnah7c UTSW 1 46739668 missense probably benign
R5663:Dnah7c UTSW 1 46535148 missense probably damaging 1.00
R5718:Dnah7c UTSW 1 46748666 missense possibly damaging 0.47
R5771:Dnah7c UTSW 1 46639665 missense probably benign 0.00
R5784:Dnah7c UTSW 1 46524068 missense possibly damaging 0.80
R5800:Dnah7c UTSW 1 46647015 missense probably benign 0.01
R5933:Dnah7c UTSW 1 46519215 missense probably damaging 1.00
R5948:Dnah7c UTSW 1 46672497 missense probably benign 0.21
R6034:Dnah7c UTSW 1 46457258 missense probably benign 0.00
R6034:Dnah7c UTSW 1 46457258 missense probably benign 0.00
R6487:Dnah7c UTSW 1 46769124 missense probably damaging 1.00
R6536:Dnah7c UTSW 1 46658290 missense probably benign 0.00
R6614:Dnah7c UTSW 1 46649340 missense probably benign
R6614:Dnah7c UTSW 1 46649351 missense probably benign
R6615:Dnah7c UTSW 1 46515439 missense probably benign 0.01
R6615:Dnah7c UTSW 1 46649340 missense probably benign
R6615:Dnah7c UTSW 1 46649351 missense probably benign
R6649:Dnah7c UTSW 1 46649340 missense probably benign
R6649:Dnah7c UTSW 1 46649351 missense probably benign
R6650:Dnah7c UTSW 1 46649340 missense probably benign
R6650:Dnah7c UTSW 1 46649351 missense probably benign
R6651:Dnah7c UTSW 1 46649340 missense probably benign
R6651:Dnah7c UTSW 1 46649351 missense probably benign
R6653:Dnah7c UTSW 1 46649340 missense probably benign
R6653:Dnah7c UTSW 1 46649351 missense probably benign
R6714:Dnah7c UTSW 1 46740806 missense probably damaging 0.99
R6729:Dnah7c UTSW 1 46672521 missense possibly damaging 0.46
R6760:Dnah7c UTSW 1 46649340 missense probably benign
R6760:Dnah7c UTSW 1 46649351 missense probably benign
R6763:Dnah7c UTSW 1 46628890 missense possibly damaging 0.60
R6866:Dnah7c UTSW 1 46657243 missense probably damaging 1.00
R6880:Dnah7c UTSW 1 46527671 missense probably damaging 0.97
R6988:Dnah7c UTSW 1 46666213 missense possibly damaging 0.68
R6995:Dnah7c UTSW 1 46455813 missense probably benign 0.07
R7007:Dnah7c UTSW 1 46532750 missense probably benign 0.04
R7086:Dnah7c UTSW 1 46750125 missense probably benign 0.00
R7128:Dnah7c UTSW 1 46527485 missense probably benign
R7131:Dnah7c UTSW 1 46681772 missense probably benign 0.00
R7135:Dnah7c UTSW 1 46533208 missense probably damaging 1.00
R7171:Dnah7c UTSW 1 46680738 missense probably damaging 0.99
R7176:Dnah7c UTSW 1 46430809 missense probably benign 0.00
R7221:Dnah7c UTSW 1 46455777 missense possibly damaging 0.87
R7310:Dnah7c UTSW 1 46596967 missense possibly damaging 0.94
R7319:Dnah7c UTSW 1 46780775 missense probably benign 0.31
R7319:Dnah7c UTSW 1 46784448 missense possibly damaging 0.95
R7404:Dnah7c UTSW 1 46666063 missense possibly damaging 0.52
R7452:Dnah7c UTSW 1 46647036 missense possibly damaging 0.91
R7515:Dnah7c UTSW 1 46457290 missense probably benign
R7534:Dnah7c UTSW 1 46770067 missense probably damaging 0.98
R7542:Dnah7c UTSW 1 46784498 missense probably benign 0.00
R7605:Dnah7c UTSW 1 46632310 missense probably damaging 1.00
R7643:Dnah7c UTSW 1 46602813 missense probably benign
R7770:Dnah7c UTSW 1 46626300 splice site probably null
R7884:Dnah7c UTSW 1 46791769 missense probably benign 0.23
R7899:Dnah7c UTSW 1 46514701 missense probably benign 0.00
R8025:Dnah7c UTSW 1 46457296 missense probably benign 0.01
R8057:Dnah7c UTSW 1 46688952 missense possibly damaging 0.52
R8191:Dnah7c UTSW 1 46607458 missense possibly damaging 0.56
R8255:Dnah7c UTSW 1 46659429 missense probably damaging 1.00
R8428:Dnah7c UTSW 1 46672376 missense probably damaging 1.00
R8441:Dnah7c UTSW 1 46533238 missense probably damaging 1.00
R8485:Dnah7c UTSW 1 46680792 missense probably benign 0.05
R8559:Dnah7c UTSW 1 46725139 missense probably damaging 1.00
R8752:Dnah7c UTSW 1 46672541 missense probably benign 0.00
R8869:Dnah7c UTSW 1 46632344 missense probably damaging 0.97
R9058:Dnah7c UTSW 1 46766656 missense probably damaging 0.97
R9121:Dnah7c UTSW 1 46665490 missense probably damaging 0.97
R9121:Dnah7c UTSW 1 46777736 missense probably benign 0.00
R9246:Dnah7c UTSW 1 46532774 missense possibly damaging 0.51
R9319:Dnah7c UTSW 1 46482008 missense possibly damaging 0.94
R9388:Dnah7c UTSW 1 46740726 missense probably damaging 1.00
Z1176:Dnah7c UTSW 1 46467302 missense probably benign 0.00
Z1176:Dnah7c UTSW 1 46615281 missense probably damaging 1.00
Z1176:Dnah7c UTSW 1 46639665 missense probably benign
Z1176:Dnah7c UTSW 1 46646992 critical splice acceptor site probably null
Z1176:Dnah7c UTSW 1 46760316 missense possibly damaging 0.95
Z1177:Dnah7c UTSW 1 46654103 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CTTGTCTGTCTATGCAGCAAGTG -3'
(R):5'- TGGGAAAATGTTCACCCTGGC -3'

Sequencing Primer
(F):5'- GTCTGTCTATGCAGCAAGTGAAAAC -3'
(R):5'- CTGGGATCACATTTTCCCT -3'
Posted On 2016-11-21