Incidental Mutation 'R5759:Gm14409'
ID445175
Institutional Source Beutler Lab
Gene Symbol Gm14409
Ensembl Gene ENSMUSG00000078869
Gene Namepredicted gene 14409
Synonyms
MMRRC Submission 043361-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R5759 (G1)
Quality Score200
Status Not validated
Chromosome2
Chromosomal Location177264654-177267036 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 177264972 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 244 (C244*)
Ref Sequence ENSEMBL: ENSMUSP00000104591 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108963]
Predicted Effect probably null
Transcript: ENSMUST00000108963
AA Change: C244*
SMART Domains Protein: ENSMUSP00000104591
Gene: ENSMUSG00000078869
AA Change: C244*

DomainStartEndE-ValueType
Blast:KRAB 1 34 3e-14 BLAST
ZnF_C2H2 46 65 1.31e2 SMART
ZnF_C2H2 71 93 8.47e-4 SMART
ZnF_C2H2 99 121 5.99e-4 SMART
ZnF_C2H2 127 149 5.59e-4 SMART
ZnF_C2H2 155 177 2.53e-2 SMART
ZnF_C2H2 183 205 1.72e-4 SMART
ZnF_C2H2 211 233 2.12e-4 SMART
ZnF_C2H2 239 261 1.58e-3 SMART
ZnF_C2H2 267 289 1.03e-2 SMART
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.8%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,068,658 S1203P probably benign Het
Adamts1 A G 16: 85,798,048 V341A possibly damaging Het
AF529169 A T 9: 89,601,072 N757K probably benign Het
Arf2 G A 11: 103,983,633 G144S probably benign Het
Atr A G 9: 95,874,402 N862D probably benign Het
Cep295nl T C 11: 118,333,646 H124R possibly damaging Het
Chd6 C T 2: 160,983,762 V1141I possibly damaging Het
Chst5 C A 8: 111,890,210 K259N probably benign Het
Dchs1 T A 7: 105,764,176 D1144V probably damaging Het
Dmxl2 T C 9: 54,375,508 Y2795C probably damaging Het
Dnah7b A G 1: 46,277,120 N3131S probably damaging Het
Dnah7c G A 1: 46,615,367 G1436R probably damaging Het
Emp2 T A 16: 10,284,510 Y146F probably damaging Het
Exoc6 C T 19: 37,573,741 Q148* probably null Het
Fam13b T C 18: 34,497,435 D90G probably damaging Het
Fam186b T G 15: 99,279,717 Y576S probably benign Het
Fras1 T C 5: 96,709,916 V2023A probably benign Het
Grm5 A C 7: 88,026,600 M441L probably damaging Het
Hhatl A G 9: 121,788,277 Y297H probably damaging Het
Ifi30 A G 8: 70,766,544 probably benign Het
Ing2 G T 8: 47,669,005 N169K possibly damaging Het
Kat6a T G 8: 22,938,012 S1128A probably benign Het
Madd T C 2: 91,162,075 E1041G possibly damaging Het
Mcm3 CT CTT 1: 20,808,748 probably null Het
Mfsd5 G A 15: 102,281,078 G295D possibly damaging Het
Mmp20 T A 9: 7,628,377 probably null Het
Mybphl T C 3: 108,374,754 V100A probably benign Het
Ndfip2 T A 14: 105,302,316 probably null Het
Olfr862 A G 9: 19,884,188 V39A probably benign Het
Olfr869 T A 9: 20,137,932 V272E probably benign Het
Olfr905 T A 9: 38,473,535 S263T possibly damaging Het
Phf19 T G 2: 34,897,123 D443A probably damaging Het
Piezo1 A G 8: 122,507,655 V84A probably damaging Het
Sept9 A G 11: 117,352,268 I94V probably benign Het
Slc35a1 C A 4: 34,675,032 V132L probably benign Het
Sntg1 G A 1: 8,414,270 S442L probably benign Het
Tcf25 A G 8: 123,381,457 T84A probably benign Het
Tchhl1 C G 3: 93,471,556 S522R probably damaging Het
Tmem106b A G 6: 13,075,042 E76G probably damaging Het
Tnk2 C T 16: 32,680,664 P932S probably benign Het
Trib1 G A 15: 59,654,501 V307I probably benign Het
Trib3 A T 2: 152,343,295 D11E probably benign Het
Trim34b T C 7: 104,331,433 S243P possibly damaging Het
Vmn2r50 A G 7: 10,047,978 I280T probably damaging Het
Zfp445 G T 9: 122,853,146 Q577K probably benign Het
Zfp599 T C 9: 22,249,661 K403E probably damaging Het
Other mutations in Gm14409
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1549:Gm14409 UTSW 2 177265585 missense probably damaging 1.00
R2125:Gm14409 UTSW 2 177265402 missense probably damaging 1.00
R3833:Gm14409 UTSW 2 177265205 missense possibly damaging 0.64
R4438:Gm14409 UTSW 2 177265096 missense possibly damaging 0.90
R4906:Gm14409 UTSW 2 177265430 missense possibly damaging 0.90
R5083:Gm14409 UTSW 2 177265571 missense probably damaging 0.99
R5802:Gm14409 UTSW 2 177265256 missense possibly damaging 0.95
R7026:Gm14409 UTSW 2 177265568 missense probably benign 0.02
R7761:Gm14409 UTSW 2 177265517 missense possibly damaging 0.66
R7993:Gm14409 UTSW 2 177265222 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGCTTCCTTCAAAGGGTTTAC -3'
(R):5'- TCACAAAGCAGTCATCTCCGAATA -3'

Sequencing Primer
(F):5'- TCAAAGGGTTTACCACCTTGG -3'
(R):5'- GTGGTAAAGCCTTTGCACATAGC -3'
Posted On2016-11-21