Incidental Mutation 'R5759:Tchhl1'
ID 445176
Institutional Source Beutler Lab
Gene Symbol Tchhl1
Ensembl Gene ENSMUSG00000027908
Gene Name trichohyalin-like 1
Synonyms S100a17, Thhl1
MMRRC Submission 043361-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5759 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 93376061-93379287 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to G at 93378863 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 522 (S522R)
Ref Sequence ENSEMBL: ENSMUSP00000029516 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029516]
AlphaFold Q9D3P1
Predicted Effect probably damaging
Transcript: ENSMUST00000029516
AA Change: S522R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029516
Gene: ENSMUSG00000027908
AA Change: S522R

DomainStartEndE-ValueType
Pfam:S_100 4 47 1.2e-15 PFAM
low complexity region 111 124 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.8%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the S100 fused-type protein (SFTP) gene family, and is located in a cluster of SFTP genes on chromosome 1q21. Several members of this family have been implicated in the development of complex skin disorders. This gene is evolutionarily conserved; its expression appears to be hair-specific and spatially restricted within the distal inner root sheath of the hair follicle. It thus may have an important role in hair morphogenesis. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 137,774,419 (GRCm39) S1203P probably benign Het
Adamts1 A G 16: 85,594,936 (GRCm39) V341A possibly damaging Het
Arf2 G A 11: 103,874,459 (GRCm39) G144S probably benign Het
Atr A G 9: 95,756,455 (GRCm39) N862D probably benign Het
Cep295nl T C 11: 118,224,472 (GRCm39) H124R possibly damaging Het
Chd6 C T 2: 160,825,682 (GRCm39) V1141I possibly damaging Het
Chst5 C A 8: 112,616,842 (GRCm39) K259N probably benign Het
Dchs1 T A 7: 105,413,383 (GRCm39) D1144V probably damaging Het
Dmxl2 T C 9: 54,282,792 (GRCm39) Y2795C probably damaging Het
Dnah7b A G 1: 46,316,280 (GRCm39) N3131S probably damaging Het
Dnah7c G A 1: 46,654,527 (GRCm39) G1436R probably damaging Het
Emp2 T A 16: 10,102,374 (GRCm39) Y146F probably damaging Het
Exoc6 C T 19: 37,562,189 (GRCm39) Q148* probably null Het
Fam13b T C 18: 34,630,488 (GRCm39) D90G probably damaging Het
Fam186b T G 15: 99,177,598 (GRCm39) Y576S probably benign Het
Fras1 T C 5: 96,857,775 (GRCm39) V2023A probably benign Het
Grm5 A C 7: 87,675,808 (GRCm39) M441L probably damaging Het
Hhatl A G 9: 121,617,343 (GRCm39) Y297H probably damaging Het
Ifi30 A G 8: 71,219,188 (GRCm39) probably benign Het
Ing2 G T 8: 48,122,040 (GRCm39) N169K possibly damaging Het
Kat6a T G 8: 23,428,028 (GRCm39) S1128A probably benign Het
Madd T C 2: 90,992,420 (GRCm39) E1041G possibly damaging Het
Mcm3 CT CTT 1: 20,878,972 (GRCm39) probably null Het
Mfsd5 G A 15: 102,189,513 (GRCm39) G295D possibly damaging Het
Minar1 A T 9: 89,483,125 (GRCm39) N757K probably benign Het
Mmp20 T A 9: 7,628,378 (GRCm39) probably null Het
Mybphl T C 3: 108,282,070 (GRCm39) V100A probably benign Het
Ndfip2 T A 14: 105,539,750 (GRCm39) probably null Het
Or7e170 A G 9: 19,795,484 (GRCm39) V39A probably benign Het
Or7e175 T A 9: 20,049,228 (GRCm39) V272E probably benign Het
Or8b1c T A 9: 38,384,831 (GRCm39) S263T possibly damaging Het
Phf19 T G 2: 34,787,135 (GRCm39) D443A probably damaging Het
Piezo1 A G 8: 123,234,394 (GRCm39) V84A probably damaging Het
Septin9 A G 11: 117,243,094 (GRCm39) I94V probably benign Het
Slc35a1 C A 4: 34,675,032 (GRCm39) V132L probably benign Het
Sntg1 G A 1: 8,484,494 (GRCm39) S442L probably benign Het
Tcf25 A G 8: 124,108,196 (GRCm39) T84A probably benign Het
Tmem106b A G 6: 13,075,041 (GRCm39) E76G probably damaging Het
Tnk2 C T 16: 32,499,482 (GRCm39) P932S probably benign Het
Trib1 G A 15: 59,526,350 (GRCm39) V307I probably benign Het
Trib3 A T 2: 152,185,215 (GRCm39) D11E probably benign Het
Trim34b T C 7: 103,980,640 (GRCm39) S243P possibly damaging Het
Vmn2r50 A G 7: 9,781,905 (GRCm39) I280T probably damaging Het
Zfp1010 A T 2: 176,956,765 (GRCm39) C244* probably null Het
Zfp445 G T 9: 122,682,211 (GRCm39) Q577K probably benign Het
Zfp599 T C 9: 22,160,957 (GRCm39) K403E probably damaging Het
Other mutations in Tchhl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Tchhl1 APN 3 93,378,230 (GRCm39) missense probably benign 0.00
IGL00803:Tchhl1 APN 3 93,378,207 (GRCm39) missense probably benign 0.00
IGL01075:Tchhl1 APN 3 93,377,623 (GRCm39) missense probably damaging 1.00
IGL01814:Tchhl1 APN 3 93,377,656 (GRCm39) missense possibly damaging 0.53
IGL02026:Tchhl1 APN 3 93,377,862 (GRCm39) missense probably damaging 0.99
IGL02407:Tchhl1 APN 3 93,378,634 (GRCm39) missense possibly damaging 0.95
IGL03286:Tchhl1 APN 3 93,378,430 (GRCm39) missense probably benign 0.00
IGL03293:Tchhl1 APN 3 93,377,582 (GRCm39) missense probably damaging 1.00
Reef UTSW 3 93,378,336 (GRCm39) nonsense probably null
R0371:Tchhl1 UTSW 3 93,376,884 (GRCm39) missense probably damaging 1.00
R0403:Tchhl1 UTSW 3 93,378,336 (GRCm39) nonsense probably null
R0763:Tchhl1 UTSW 3 93,378,878 (GRCm39) missense probably benign 0.05
R1052:Tchhl1 UTSW 3 93,377,520 (GRCm39) missense probably benign 0.32
R1848:Tchhl1 UTSW 3 93,378,408 (GRCm39) missense probably damaging 1.00
R4917:Tchhl1 UTSW 3 93,377,623 (GRCm39) missense possibly damaging 0.52
R4918:Tchhl1 UTSW 3 93,377,623 (GRCm39) missense possibly damaging 0.52
R4945:Tchhl1 UTSW 3 93,378,883 (GRCm39) missense probably benign 0.00
R5251:Tchhl1 UTSW 3 93,377,860 (GRCm39) missense possibly damaging 0.70
R5260:Tchhl1 UTSW 3 93,378,102 (GRCm39) missense probably damaging 1.00
R5398:Tchhl1 UTSW 3 93,378,910 (GRCm39) missense probably benign 0.01
R5760:Tchhl1 UTSW 3 93,378,863 (GRCm39) missense probably damaging 1.00
R5872:Tchhl1 UTSW 3 93,377,836 (GRCm39) missense probably benign 0.31
R6592:Tchhl1 UTSW 3 93,378,116 (GRCm39) missense probably damaging 0.99
R7464:Tchhl1 UTSW 3 93,377,971 (GRCm39) missense probably benign 0.01
R7653:Tchhl1 UTSW 3 93,378,451 (GRCm39) missense probably benign 0.01
R7726:Tchhl1 UTSW 3 93,379,065 (GRCm39) missense probably benign 0.07
R8487:Tchhl1 UTSW 3 93,376,869 (GRCm39) missense probably damaging 1.00
R9207:Tchhl1 UTSW 3 93,377,819 (GRCm39) missense possibly damaging 0.94
RF018:Tchhl1 UTSW 3 93,377,691 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCTGCAGCTGAAGAGACATTG -3'
(R):5'- AGCTGCCCATCTTCTTGGATTG -3'

Sequencing Primer
(F):5'- AGCTGGCACCACTTGAGAAG -3'
(R):5'- ATCTTCTTGGATTGACAGCACTAC -3'
Posted On 2016-11-21