Incidental Mutation 'R0027:Capn12'
ID 44519
Institutional Source Beutler Lab
Gene Symbol Capn12
Ensembl Gene ENSMUSG00000054083
Gene Name calpain 12
Synonyms
MMRRC Submission 038322-MU
Accession Numbers

Ncbi RefSeq: NM_001110807.1; MGI: 1891369

Essential gene? Non essential (E-score: 0.000) question?
Stock # R0027 (G1) of strain 730
Quality Score 225
Status Validated (trace)
Chromosome 7
Chromosomal Location 28881422-28893563 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 28881960 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 79 (H79Q)
Ref Sequence ENSEMBL: ENSMUSP00000069055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066880]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000066880
AA Change: H79Q

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000069055
Gene: ENSMUSG00000054083
AA Change: H79Q

DomainStartEndE-ValueType
CysPc 27 349 7.8e-139 SMART
calpain_III 353 529 7.47e-72 SMART
SCOP:d1alva_ 552 720 3e-14 SMART
Meta Mutation Damage Score 0.0938 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The calpains, calcium-activated neutral proteases, are nonlysosomal, intracellular cysteine proteases. The mammalian calpains include ubiquitous, stomach-specific, and muscle-specific proteins. The ubiquitous enzymes consist of heterodimers with distinct large, catalytic subunits associated with a common small, regulatory subunit. This gene encodes a member of the calpain large subunit family. [provided by RefSeq, Jun 2012]
Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts12 A T 15: 11,285,873 I723F probably damaging Het
Anapc1 G T 2: 128,641,511 D1221E possibly damaging Het
Arhgef28 T A 13: 97,945,696 E1201V possibly damaging Het
Caprin1 A T 2: 103,775,580 probably benign Het
Carmil3 T A 14: 55,494,403 F196Y probably damaging Het
Casp8ap2 A G 4: 32,643,810 H961R probably benign Het
Cdkl3 C T 11: 52,032,349 probably benign Het
Cic T A 7: 25,287,140 S1299T probably damaging Het
Cic C A 7: 25,287,141 S1299Y probably damaging Het
Col13a1 A G 10: 61,850,161 L684P unknown Het
D10Wsu102e G A 10: 83,364,529 probably benign Het
D430041D05Rik A T 2: 104,255,044 F1053L probably benign Het
Dab1 T C 4: 104,704,199 probably benign Het
Dmxl1 A T 18: 49,957,295 probably benign Het
Dst C T 1: 34,189,119 P1606L probably damaging Het
E130309D02Rik G A 5: 143,308,062 T220I probably damaging Het
Eml1 T C 12: 108,536,298 C708R possibly damaging Het
Fam131b T A 6: 42,318,248 M304L probably benign Het
Foxk1 A T 5: 142,450,340 I321F probably damaging Het
Gm10306 C T 4: 94,556,790 probably benign Het
Gm10985 TA TANA 3: 53,845,256 probably null Het
Gse1 T C 8: 120,566,546 probably benign Het
Hcn3 A G 3: 89,159,825 S79P probably damaging Het
Hspa4 T A 11: 53,283,585 M203L probably benign Het
Kctd7 G A 5: 130,152,573 R279H probably damaging Het
Kif11 C T 19: 37,406,983 probably benign Het
Klf13 T C 7: 63,891,761 N206S probably benign Het
Kpna7 A T 5: 144,989,697 Y482N probably damaging Het
Lamc1 T C 1: 153,262,583 Y175C probably damaging Het
Lrpprc G A 17: 84,767,007 R491* probably null Het
Madd T A 2: 91,152,549 I1350F probably damaging Het
Mbtd1 T C 11: 93,924,549 V321A possibly damaging Het
Mon2 G A 10: 123,036,048 S357L possibly damaging Het
Ndst3 A G 3: 123,671,513 V270A probably damaging Het
Nlrp2 T C 7: 5,322,448 T742A probably damaging Het
Olfr214 T C 6: 116,556,949 S175P probably damaging Het
Papola A C 12: 105,833,136 S675R probably benign Het
Pcdh9 T A 14: 93,888,645 I30F probably null Het
Prl6a1 T A 13: 27,318,028 L126Q probably damaging Het
Prr29 A G 11: 106,376,276 E89G possibly damaging Het
Psmd1 T C 1: 86,094,265 probably benign Het
Rad9b A G 5: 122,351,723 probably benign Het
Rest T C 5: 77,282,551 V939A probably benign Het
Rnf135 T A 11: 80,193,942 S180R probably benign Het
Sarm1 C A 11: 78,488,091 R376L probably damaging Het
Scap C A 9: 110,379,730 P613Q probably benign Het
Scube3 C T 17: 28,164,357 R374* probably null Het
Setx T G 2: 29,139,221 V167G probably damaging Het
Snrnp40 T A 4: 130,368,273 H151Q probably damaging Het
Sox21 G T 14: 118,235,617 H7N probably benign Het
Stard9 A T 2: 120,703,501 Q3413L probably benign Het
Sycp1 A G 3: 102,895,910 V528A probably benign Het
Tcl1b3 A T 12: 105,191,239 S47C probably damaging Het
Treml4 T C 17: 48,264,934 S122P possibly damaging Het
Trip11 C T 12: 101,885,169 A879T probably benign Het
Ubr4 C A 4: 139,400,393 N567K probably damaging Het
Zan T C 5: 137,406,519 probably benign Het
Zfp804a G A 2: 82,257,200 D458N probably damaging Het
Zic2 T C 14: 122,476,343 M223T possibly damaging Het
Other mutations in Capn12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01717:Capn12 APN 7 28889105 missense probably benign
IGL01758:Capn12 APN 7 28886623 splice site probably null
IGL02381:Capn12 APN 7 28886455 splice site probably benign
IGL02863:Capn12 APN 7 28883156 missense probably damaging 1.00
IGL03237:Capn12 APN 7 28890941 missense probably damaging 1.00
PIT4418001:Capn12 UTSW 7 28886536 missense probably benign 0.06
R0047:Capn12 UTSW 7 28890387 critical splice donor site probably null
R0047:Capn12 UTSW 7 28890387 critical splice donor site probably null
R0070:Capn12 UTSW 7 28889126 unclassified probably benign
R0070:Capn12 UTSW 7 28889126 unclassified probably benign
R0533:Capn12 UTSW 7 28887683 missense possibly damaging 0.48
R0932:Capn12 UTSW 7 28887698 missense possibly damaging 0.91
R1524:Capn12 UTSW 7 28882764 splice site probably benign
R4758:Capn12 UTSW 7 28892723 missense possibly damaging 0.66
R4793:Capn12 UTSW 7 28892669 missense probably benign 0.23
R4983:Capn12 UTSW 7 28890370 missense probably benign 0.00
R5560:Capn12 UTSW 7 28882860 missense probably benign 0.01
R5835:Capn12 UTSW 7 28881958 missense probably benign 0.05
R5886:Capn12 UTSW 7 28887605 missense probably benign 0.01
R6247:Capn12 UTSW 7 28888652 missense probably benign 0.05
R6441:Capn12 UTSW 7 28888002 missense probably benign 0.00
R7136:Capn12 UTSW 7 28883107 splice site probably null
R7757:Capn12 UTSW 7 28882821 missense probably damaging 1.00
R8329:Capn12 UTSW 7 28883201 missense probably damaging 1.00
R8888:Capn12 UTSW 7 28886524 splice site probably benign
R8924:Capn12 UTSW 7 28883203 missense probably damaging 1.00
R9150:Capn12 UTSW 7 28890953 missense probably benign 0.11
R9209:Capn12 UTSW 7 28881818 missense probably damaging 1.00
Z1177:Capn12 UTSW 7 28887828 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAAGGGAGAATGCTCCTCGATGC -3'
(R):5'- ACACTCAAGGGTTCATGTCCTGGC -3'

Sequencing Primer
(F):5'- GAATGCTCCTCGATGCCTAAAG -3'
(R):5'- TGATCCCTCAGGCTAAGACTC -3'
Posted On 2013-06-11