Incidental Mutation 'R5759:Tcf25'
ID445192
Institutional Source Beutler Lab
Gene Symbol Tcf25
Ensembl Gene ENSMUSG00000001472
Gene Nametranscription factor 25 (basic helix-loop-helix)
Synonyms1100001J13Rik, Nulp1, D8Ertd325e, 1810041K11Rik
MMRRC Submission 043361-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5759 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location123373753-123403835 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 123381457 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 84 (T84A)
Ref Sequence ENSEMBL: ENSMUSP00000148676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057934] [ENSMUST00000108840] [ENSMUST00000127664] [ENSMUST00000211932] [ENSMUST00000212470] [ENSMUST00000212569] [ENSMUST00000212571]
Predicted Effect probably benign
Transcript: ENSMUST00000057934
AA Change: T84A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000056485
Gene: ENSMUSG00000001472
AA Change: T84A

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
low complexity region 34 55 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
Pfam:Tcf25 248 588 4.6e-120 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108840
AA Change: T84A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104468
Gene: ENSMUSG00000001472
AA Change: T84A

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
low complexity region 34 55 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
Pfam:Tcf25 247 588 2.3e-113 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000211932
AA Change: T84A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211964
Predicted Effect probably benign
Transcript: ENSMUST00000212470
AA Change: T84A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212498
Predicted Effect probably benign
Transcript: ENSMUST00000212569
AA Change: T84A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000212571
AA Change: T84A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.8%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TCF25 is a member of the basic helix-loop-helix (bHLH) family of transcription factors that are important in embryonic development (Steen and Lindholm, 2008 [PubMed 18068114]).[supplied by OMIM, Sep 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,068,658 S1203P probably benign Het
Adamts1 A G 16: 85,798,048 V341A possibly damaging Het
AF529169 A T 9: 89,601,072 N757K probably benign Het
Arf2 G A 11: 103,983,633 G144S probably benign Het
Atr A G 9: 95,874,402 N862D probably benign Het
Cep295nl T C 11: 118,333,646 H124R possibly damaging Het
Chd6 C T 2: 160,983,762 V1141I possibly damaging Het
Chst5 C A 8: 111,890,210 K259N probably benign Het
Dchs1 T A 7: 105,764,176 D1144V probably damaging Het
Dmxl2 T C 9: 54,375,508 Y2795C probably damaging Het
Dnah7b A G 1: 46,277,120 N3131S probably damaging Het
Dnah7c G A 1: 46,615,367 G1436R probably damaging Het
Emp2 T A 16: 10,284,510 Y146F probably damaging Het
Exoc6 C T 19: 37,573,741 Q148* probably null Het
Fam13b T C 18: 34,497,435 D90G probably damaging Het
Fam186b T G 15: 99,279,717 Y576S probably benign Het
Fras1 T C 5: 96,709,916 V2023A probably benign Het
Gm14409 A T 2: 177,264,972 C244* probably null Het
Grm5 A C 7: 88,026,600 M441L probably damaging Het
Hhatl A G 9: 121,788,277 Y297H probably damaging Het
Ifi30 A G 8: 70,766,544 probably benign Het
Ing2 G T 8: 47,669,005 N169K possibly damaging Het
Kat6a T G 8: 22,938,012 S1128A probably benign Het
Madd T C 2: 91,162,075 E1041G possibly damaging Het
Mcm3 CT CTT 1: 20,808,748 probably null Het
Mfsd5 G A 15: 102,281,078 G295D possibly damaging Het
Mmp20 T A 9: 7,628,377 probably null Het
Mybphl T C 3: 108,374,754 V100A probably benign Het
Ndfip2 T A 14: 105,302,316 probably null Het
Olfr862 A G 9: 19,884,188 V39A probably benign Het
Olfr869 T A 9: 20,137,932 V272E probably benign Het
Olfr905 T A 9: 38,473,535 S263T possibly damaging Het
Phf19 T G 2: 34,897,123 D443A probably damaging Het
Piezo1 A G 8: 122,507,655 V84A probably damaging Het
Sept9 A G 11: 117,352,268 I94V probably benign Het
Slc35a1 C A 4: 34,675,032 V132L probably benign Het
Sntg1 G A 1: 8,414,270 S442L probably benign Het
Tchhl1 C G 3: 93,471,556 S522R probably damaging Het
Tmem106b A G 6: 13,075,042 E76G probably damaging Het
Tnk2 C T 16: 32,680,664 P932S probably benign Het
Trib1 G A 15: 59,654,501 V307I probably benign Het
Trib3 A T 2: 152,343,295 D11E probably benign Het
Trim34b T C 7: 104,331,433 S243P possibly damaging Het
Vmn2r50 A G 7: 10,047,978 I280T probably damaging Het
Zfp445 G T 9: 122,853,146 Q577K probably benign Het
Zfp599 T C 9: 22,249,661 K403E probably damaging Het
Other mutations in Tcf25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01790:Tcf25 APN 8 123393236 missense possibly damaging 0.87
IGL02638:Tcf25 APN 8 123399292 missense probably damaging 1.00
IGL03112:Tcf25 APN 8 123382519 splice site probably benign
R0492:Tcf25 UTSW 8 123381464 missense probably benign 0.00
R1081:Tcf25 UTSW 8 123381473 missense probably benign 0.00
R1543:Tcf25 UTSW 8 123388587 missense probably benign 0.01
R1634:Tcf25 UTSW 8 123397091 missense possibly damaging 0.68
R1662:Tcf25 UTSW 8 123381550 missense probably benign 0.00
R2253:Tcf25 UTSW 8 123374033 missense probably benign 0.21
R4326:Tcf25 UTSW 8 123401143 nonsense probably null
R4327:Tcf25 UTSW 8 123401143 nonsense probably null
R4667:Tcf25 UTSW 8 123397025 missense possibly damaging 0.89
R4977:Tcf25 UTSW 8 123388635 missense probably benign 0.03
R5248:Tcf25 UTSW 8 123373939 missense probably damaging 1.00
R5249:Tcf25 UTSW 8 123388633 missense probably damaging 1.00
R5806:Tcf25 UTSW 8 123381504 missense probably benign 0.09
R5813:Tcf25 UTSW 8 123395615 unclassified probably null
R5905:Tcf25 UTSW 8 123381437 missense possibly damaging 0.78
R6028:Tcf25 UTSW 8 123381437 missense possibly damaging 0.78
R6114:Tcf25 UTSW 8 123384375 missense probably damaging 1.00
R6349:Tcf25 UTSW 8 123391593 missense probably damaging 1.00
R6904:Tcf25 UTSW 8 123400698 critical splice donor site probably null
R7232:Tcf25 UTSW 8 123401061 splice site probably null
R7287:Tcf25 UTSW 8 123373972 missense possibly damaging 0.74
RF007:Tcf25 UTSW 8 123395630 missense probably benign 0.03
Z1176:Tcf25 UTSW 8 123373906 missense unknown
Predicted Primers PCR Primer
(F):5'- CACAGTCCTCCCTATTGACAG -3'
(R):5'- TTCAAGAAACTGGTAGTGCAGG -3'

Sequencing Primer
(F):5'- GACAGTCCTCCCCATTCACTG -3'
(R):5'- TGGATGTGGCCAGCACCTC -3'
Posted On2016-11-21