Incidental Mutation 'R5759:Olfr905'
ID445196
Institutional Source Beutler Lab
Gene Symbol Olfr905
Ensembl Gene ENSMUSG00000096794
Gene Nameolfactory receptor 905
SynonymsMOR167-1, GA_x6K02T2PVTD-32165709-32166641
MMRRC Submission 043361-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R5759 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location38471107-38477013 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 38473535 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 263 (S263T)
Ref Sequence ENSEMBL: ENSMUSP00000150357 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051111] [ENSMUST00000214377] [ENSMUST00000216724]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051111
AA Change: S263T

PolyPhen 2 Score 0.725 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000057998
Gene: ENSMUSG00000096794
AA Change: S263T

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.9e-50 PFAM
Pfam:7tm_1 41 298 4e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214377
AA Change: S263T

PolyPhen 2 Score 0.725 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect probably benign
Transcript: ENSMUST00000216724
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.8%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,068,658 S1203P probably benign Het
Adamts1 A G 16: 85,798,048 V341A possibly damaging Het
AF529169 A T 9: 89,601,072 N757K probably benign Het
Arf2 G A 11: 103,983,633 G144S probably benign Het
Atr A G 9: 95,874,402 N862D probably benign Het
Cep295nl T C 11: 118,333,646 H124R possibly damaging Het
Chd6 C T 2: 160,983,762 V1141I possibly damaging Het
Chst5 C A 8: 111,890,210 K259N probably benign Het
Dchs1 T A 7: 105,764,176 D1144V probably damaging Het
Dmxl2 T C 9: 54,375,508 Y2795C probably damaging Het
Dnah7b A G 1: 46,277,120 N3131S probably damaging Het
Dnah7c G A 1: 46,615,367 G1436R probably damaging Het
Emp2 T A 16: 10,284,510 Y146F probably damaging Het
Exoc6 C T 19: 37,573,741 Q148* probably null Het
Fam13b T C 18: 34,497,435 D90G probably damaging Het
Fam186b T G 15: 99,279,717 Y576S probably benign Het
Fras1 T C 5: 96,709,916 V2023A probably benign Het
Gm14409 A T 2: 177,264,972 C244* probably null Het
Grm5 A C 7: 88,026,600 M441L probably damaging Het
Hhatl A G 9: 121,788,277 Y297H probably damaging Het
Ifi30 A G 8: 70,766,544 probably benign Het
Ing2 G T 8: 47,669,005 N169K possibly damaging Het
Kat6a T G 8: 22,938,012 S1128A probably benign Het
Madd T C 2: 91,162,075 E1041G possibly damaging Het
Mcm3 CT CTT 1: 20,808,748 probably null Het
Mfsd5 G A 15: 102,281,078 G295D possibly damaging Het
Mmp20 T A 9: 7,628,377 probably null Het
Mybphl T C 3: 108,374,754 V100A probably benign Het
Ndfip2 T A 14: 105,302,316 probably null Het
Olfr862 A G 9: 19,884,188 V39A probably benign Het
Olfr869 T A 9: 20,137,932 V272E probably benign Het
Phf19 T G 2: 34,897,123 D443A probably damaging Het
Piezo1 A G 8: 122,507,655 V84A probably damaging Het
Sept9 A G 11: 117,352,268 I94V probably benign Het
Slc35a1 C A 4: 34,675,032 V132L probably benign Het
Sntg1 G A 1: 8,414,270 S442L probably benign Het
Tcf25 A G 8: 123,381,457 T84A probably benign Het
Tchhl1 C G 3: 93,471,556 S522R probably damaging Het
Tmem106b A G 6: 13,075,042 E76G probably damaging Het
Tnk2 C T 16: 32,680,664 P932S probably benign Het
Trib1 G A 15: 59,654,501 V307I probably benign Het
Trib3 A T 2: 152,343,295 D11E probably benign Het
Trim34b T C 7: 104,331,433 S243P possibly damaging Het
Vmn2r50 A G 7: 10,047,978 I280T probably damaging Het
Zfp445 G T 9: 122,853,146 Q577K probably benign Het
Zfp599 T C 9: 22,249,661 K403E probably damaging Het
Other mutations in Olfr905
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Olfr905 APN 9 38473042 missense possibly damaging 0.52
IGL03168:Olfr905 APN 9 38473019 missense probably benign
R0003:Olfr905 UTSW 9 38473316 missense probably benign 0.24
R0062:Olfr905 UTSW 9 38473258 missense probably benign 0.03
R0625:Olfr905 UTSW 9 38473208 missense possibly damaging 0.90
R0744:Olfr905 UTSW 9 38472785 missense probably benign 0.04
R0836:Olfr905 UTSW 9 38472785 missense probably benign 0.04
R2085:Olfr905 UTSW 9 38472927 missense probably damaging 1.00
R2898:Olfr905 UTSW 9 38472975 missense probably damaging 0.99
R4462:Olfr905 UTSW 9 38473064 missense probably benign 0.32
R4655:Olfr905 UTSW 9 38472824 missense probably damaging 0.99
R5209:Olfr905 UTSW 9 38473521 missense possibly damaging 0.52
R6453:Olfr905 UTSW 9 38473575 missense probably benign 0.18
R6501:Olfr905 UTSW 9 38473289 missense possibly damaging 0.88
R6934:Olfr905 UTSW 9 38473176 missense probably benign
R6999:Olfr905 UTSW 9 38473239 missense probably damaging 1.00
R7295:Olfr905 UTSW 9 38473443 missense probably benign 0.07
R7677:Olfr905 UTSW 9 38473535 missense possibly damaging 0.73
R7708:Olfr905 UTSW 9 38473385 missense probably damaging 1.00
X0053:Olfr905 UTSW 9 38473176 missense probably benign
X0065:Olfr905 UTSW 9 38473006 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GCACCAGCACCTATGTCAATG -3'
(R):5'- AGTAACTACATGAGGAAGGACACTC -3'

Sequencing Primer
(F):5'- AGCACCTATGTCAATGAACTGG -3'
(R):5'- GAGGAAGGACACTCGTTCATTTTAAC -3'
Posted On2016-11-21