Incidental Mutation 'R5759:Sept9'
ID445203
Institutional Source Beutler Lab
Gene Symbol Sept9
Ensembl Gene ENSMUSG00000059248
Gene Nameseptin 9
SynonymsPNUTL4, Msf, Sint1, SL3-3 integration site 1, MSF1
MMRRC Submission 043361-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5759 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location117199661-117362325 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 117352268 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 94 (I94V)
Ref Sequence ENSEMBL: ENSMUSP00000101956 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019038] [ENSMUST00000093907] [ENSMUST00000100193] [ENSMUST00000106349] [ENSMUST00000106354] [ENSMUST00000127383] [ENSMUST00000153668]
Predicted Effect probably benign
Transcript: ENSMUST00000019038
AA Change: I336V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000019038
Gene: ENSMUSG00000059248
AA Change: I336V

DomainStartEndE-ValueType
Pfam:DUF258 265 379 5.3e-8 PFAM
Pfam:Septin 286 565 1.2e-112 PFAM
Pfam:GTP_EFTU 289 365 1.5e-5 PFAM
Pfam:AIG1 290 379 3.1e-7 PFAM
Pfam:MMR_HSR1 291 481 1.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093907
AA Change: I343V

PolyPhen 2 Score 0.152 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000091435
Gene: ENSMUSG00000059248
AA Change: I343V

DomainStartEndE-ValueType
Pfam:Septin 293 572 1.6e-112 PFAM
Pfam:MMR_HSR1 298 444 3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100193
AA Change: I94V

PolyPhen 2 Score 0.152 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000097767
Gene: ENSMUSG00000059248
AA Change: I94V

DomainStartEndE-ValueType
Pfam:DUF258 23 138 1.1e-8 PFAM
Pfam:Septin 44 323 3.4e-113 PFAM
Pfam:GTP_EFTU 47 123 6.2e-6 PFAM
Pfam:AIG1 48 138 2.4e-7 PFAM
Pfam:MMR_HSR1 49 194 4.6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106349
AA Change: I94V

PolyPhen 2 Score 0.152 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000101956
Gene: ENSMUSG00000059248
AA Change: I94V

DomainStartEndE-ValueType
Pfam:DUF258 23 138 1.1e-8 PFAM
Pfam:Septin 44 323 3.4e-113 PFAM
Pfam:GTP_EFTU 47 123 6.2e-6 PFAM
Pfam:AIG1 48 138 2.4e-7 PFAM
Pfam:MMR_HSR1 49 194 4.6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106354
AA Change: I325V

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000101961
Gene: ENSMUSG00000059248
AA Change: I325V

DomainStartEndE-ValueType
Pfam:DUF258 254 368 4.2e-8 PFAM
Pfam:Septin 275 554 3.4e-113 PFAM
Pfam:GTP_EFTU 278 354 3.7e-6 PFAM
Pfam:AIG1 279 368 1.9e-7 PFAM
Pfam:MMR_HSR1 280 378 7.6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127383
AA Change: I113V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000120065
Gene: ENSMUSG00000059248
AA Change: I113V

DomainStartEndE-ValueType
Pfam:DUF258 43 158 1.2e-8 PFAM
Pfam:Septin 63 242 6.2e-79 PFAM
Pfam:GTP_EFTU 66 142 9.2e-7 PFAM
Pfam:AIG1 67 161 4.2e-8 PFAM
Pfam:MMR_HSR1 68 222 8.9e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134852
Predicted Effect probably benign
Transcript: ENSMUST00000153668
SMART Domains Protein: ENSMUSP00000120382
Gene: ENSMUSG00000059248

DomainStartEndE-ValueType
Pfam:DUF258 16 74 1.2e-7 PFAM
Pfam:Septin 44 74 4e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155331
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.8%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the septin family involved in cytokinesis and cell cycle control. This gene is a candidate for the ovarian tumor suppressor gene. Mutations in this gene cause hereditary neuralgic amyotrophy, also known as neuritis with brachial predilection. A chromosomal translocation involving this gene on chromosome 17 and the MLL gene on chromosome 11 results in acute myelomonocytic leukemia. Multiple alternatively spliced transcript variants encoding different isoforms have been described.[provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a targeted allele exhibit embryonic lethality around E10 with generalized apoptotic degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,068,658 S1203P probably benign Het
Adamts1 A G 16: 85,798,048 V341A possibly damaging Het
AF529169 A T 9: 89,601,072 N757K probably benign Het
Arf2 G A 11: 103,983,633 G144S probably benign Het
Atr A G 9: 95,874,402 N862D probably benign Het
Cep295nl T C 11: 118,333,646 H124R possibly damaging Het
Chd6 C T 2: 160,983,762 V1141I possibly damaging Het
Chst5 C A 8: 111,890,210 K259N probably benign Het
Dchs1 T A 7: 105,764,176 D1144V probably damaging Het
Dmxl2 T C 9: 54,375,508 Y2795C probably damaging Het
Dnah7b A G 1: 46,277,120 N3131S probably damaging Het
Dnah7c G A 1: 46,615,367 G1436R probably damaging Het
Emp2 T A 16: 10,284,510 Y146F probably damaging Het
Exoc6 C T 19: 37,573,741 Q148* probably null Het
Fam13b T C 18: 34,497,435 D90G probably damaging Het
Fam186b T G 15: 99,279,717 Y576S probably benign Het
Fras1 T C 5: 96,709,916 V2023A probably benign Het
Gm14409 A T 2: 177,264,972 C244* probably null Het
Grm5 A C 7: 88,026,600 M441L probably damaging Het
Hhatl A G 9: 121,788,277 Y297H probably damaging Het
Ifi30 A G 8: 70,766,544 probably benign Het
Ing2 G T 8: 47,669,005 N169K possibly damaging Het
Kat6a T G 8: 22,938,012 S1128A probably benign Het
Madd T C 2: 91,162,075 E1041G possibly damaging Het
Mcm3 CT CTT 1: 20,808,748 probably null Het
Mfsd5 G A 15: 102,281,078 G295D possibly damaging Het
Mmp20 T A 9: 7,628,377 probably null Het
Mybphl T C 3: 108,374,754 V100A probably benign Het
Ndfip2 T A 14: 105,302,316 probably null Het
Olfr862 A G 9: 19,884,188 V39A probably benign Het
Olfr869 T A 9: 20,137,932 V272E probably benign Het
Olfr905 T A 9: 38,473,535 S263T possibly damaging Het
Phf19 T G 2: 34,897,123 D443A probably damaging Het
Piezo1 A G 8: 122,507,655 V84A probably damaging Het
Slc35a1 C A 4: 34,675,032 V132L probably benign Het
Sntg1 G A 1: 8,414,270 S442L probably benign Het
Tcf25 A G 8: 123,381,457 T84A probably benign Het
Tchhl1 C G 3: 93,471,556 S522R probably damaging Het
Tmem106b A G 6: 13,075,042 E76G probably damaging Het
Tnk2 C T 16: 32,680,664 P932S probably benign Het
Trib1 G A 15: 59,654,501 V307I probably benign Het
Trib3 A T 2: 152,343,295 D11E probably benign Het
Trim34b T C 7: 104,331,433 S243P possibly damaging Het
Vmn2r50 A G 7: 10,047,978 I280T probably damaging Het
Zfp445 G T 9: 122,853,146 Q577K probably benign Het
Zfp599 T C 9: 22,249,661 K403E probably damaging Het
Other mutations in Sept9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Sept9 APN 11 117352184 missense probably damaging 1.00
IGL00230:Sept9 APN 11 117354804 unclassified probably benign
IGL01520:Sept9 APN 11 117352643 missense probably damaging 1.00
IGL01905:Sept9 APN 11 117218889 missense probably benign 0.07
IGL02502:Sept9 APN 11 117290662 missense probably damaging 1.00
R0325:Sept9 UTSW 11 117356632 missense probably damaging 0.99
R0825:Sept9 UTSW 11 117359460 missense probably damaging 1.00
R0845:Sept9 UTSW 11 117356325 unclassified probably benign
R1581:Sept9 UTSW 11 117290595 missense probably damaging 1.00
R1763:Sept9 UTSW 11 117290428 missense probably benign 0.04
R1848:Sept9 UTSW 11 117353083 unclassified probably benign
R2039:Sept9 UTSW 11 117351617 missense probably damaging 1.00
R2409:Sept9 UTSW 11 117360461 missense probably damaging 1.00
R2763:Sept9 UTSW 11 117326501 missense probably benign 0.05
R3545:Sept9 UTSW 11 117352673 missense probably damaging 1.00
R4062:Sept9 UTSW 11 117352265 missense probably damaging 1.00
R4601:Sept9 UTSW 11 117360484 missense probably damaging 1.00
R5139:Sept9 UTSW 11 117356685 missense possibly damaging 0.80
R6062:Sept9 UTSW 11 117290800 missense possibly damaging 0.89
R6134:Sept9 UTSW 11 117352161 missense probably damaging 1.00
R6509:Sept9 UTSW 11 117290427 missense probably benign
R7562:Sept9 UTSW 11 117326511 critical splice donor site probably null
R7573:Sept9 UTSW 11 117199745 start gained probably benign
R7592:Sept9 UTSW 11 117290662 missense probably damaging 1.00
R7810:Sept9 UTSW 11 117359438 nonsense probably null
R8200:Sept9 UTSW 11 117232716 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATGAACTGTGTTCTTGGAGAGC -3'
(R):5'- AGGAGCAAGTGACCTCTTCTG -3'

Sequencing Primer
(F):5'- GTGTTCTTGGAGAGCCTTCCAAC -3'
(R):5'- TGGTGCCAGCCATGACTCTTAG -3'
Posted On2016-11-21