Incidental Mutation 'R5759:Ndfip2'
ID445207
Institutional Source Beutler Lab
Gene Symbol Ndfip2
Ensembl Gene ENSMUSG00000053253
Gene NameNedd4 family interacting protein 2
Synonyms0710001O20Rik, 9130207N19Rik, N4wbp5a
MMRRC Submission 043361-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5759 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location105258573-105309298 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 105302316 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000137875 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000181969]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127286
Predicted Effect probably null
Transcript: ENSMUST00000138283
SMART Domains Protein: ENSMUSP00000121854
Gene: ENSMUSG00000053253

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
low complexity region 29 58 N/A INTRINSIC
low complexity region 103 129 N/A INTRINSIC
Pfam:DUF2370 150 266 1.4e-10 PFAM
transmembrane domain 269 291 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149358
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149781
Predicted Effect probably null
Transcript: ENSMUST00000181969
SMART Domains Protein: ENSMUSP00000137875
Gene: ENSMUSG00000053253

DomainStartEndE-ValueType
low complexity region 34 49 N/A INTRINSIC
low complexity region 55 84 N/A INTRINSIC
low complexity region 129 155 N/A INTRINSIC
Pfam:DUF2370 171 290 2.1e-37 PFAM
Pfam:DUF2370 285 333 2.9e-12 PFAM
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.8%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable and exhibit normal hematological parameters. However, when fed a low iron diet, female homozygotes display a decrease in liver iron content and are able to maintain normal serum iron levels and transferrin saturation, unlike wild-type females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,068,658 S1203P probably benign Het
Adamts1 A G 16: 85,798,048 V341A possibly damaging Het
AF529169 A T 9: 89,601,072 N757K probably benign Het
Arf2 G A 11: 103,983,633 G144S probably benign Het
Atr A G 9: 95,874,402 N862D probably benign Het
Cep295nl T C 11: 118,333,646 H124R possibly damaging Het
Chd6 C T 2: 160,983,762 V1141I possibly damaging Het
Chst5 C A 8: 111,890,210 K259N probably benign Het
Dchs1 T A 7: 105,764,176 D1144V probably damaging Het
Dmxl2 T C 9: 54,375,508 Y2795C probably damaging Het
Dnah7b A G 1: 46,277,120 N3131S probably damaging Het
Dnah7c G A 1: 46,615,367 G1436R probably damaging Het
Emp2 T A 16: 10,284,510 Y146F probably damaging Het
Exoc6 C T 19: 37,573,741 Q148* probably null Het
Fam13b T C 18: 34,497,435 D90G probably damaging Het
Fam186b T G 15: 99,279,717 Y576S probably benign Het
Fras1 T C 5: 96,709,916 V2023A probably benign Het
Gm14409 A T 2: 177,264,972 C244* probably null Het
Grm5 A C 7: 88,026,600 M441L probably damaging Het
Hhatl A G 9: 121,788,277 Y297H probably damaging Het
Ifi30 A G 8: 70,766,544 probably benign Het
Ing2 G T 8: 47,669,005 N169K possibly damaging Het
Kat6a T G 8: 22,938,012 S1128A probably benign Het
Madd T C 2: 91,162,075 E1041G possibly damaging Het
Mcm3 CT CTT 1: 20,808,748 probably null Het
Mfsd5 G A 15: 102,281,078 G295D possibly damaging Het
Mmp20 T A 9: 7,628,377 probably null Het
Mybphl T C 3: 108,374,754 V100A probably benign Het
Olfr862 A G 9: 19,884,188 V39A probably benign Het
Olfr869 T A 9: 20,137,932 V272E probably benign Het
Olfr905 T A 9: 38,473,535 S263T possibly damaging Het
Phf19 T G 2: 34,897,123 D443A probably damaging Het
Piezo1 A G 8: 122,507,655 V84A probably damaging Het
Sept9 A G 11: 117,352,268 I94V probably benign Het
Slc35a1 C A 4: 34,675,032 V132L probably benign Het
Sntg1 G A 1: 8,414,270 S442L probably benign Het
Tcf25 A G 8: 123,381,457 T84A probably benign Het
Tchhl1 C G 3: 93,471,556 S522R probably damaging Het
Tmem106b A G 6: 13,075,042 E76G probably damaging Het
Tnk2 C T 16: 32,680,664 P932S probably benign Het
Trib1 G A 15: 59,654,501 V307I probably benign Het
Trib3 A T 2: 152,343,295 D11E probably benign Het
Trim34b T C 7: 104,331,433 S243P possibly damaging Het
Vmn2r50 A G 7: 10,047,978 I280T probably damaging Het
Zfp445 G T 9: 122,853,146 Q577K probably benign Het
Zfp599 T C 9: 22,249,661 K403E probably damaging Het
Other mutations in Ndfip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
Bridge_too_far UTSW 14 105294857 missense probably damaging 1.00
PIT4486001:Ndfip2 UTSW 14 105294866 missense probably damaging 1.00
R0189:Ndfip2 UTSW 14 105304740 missense probably damaging 1.00
R2156:Ndfip2 UTSW 14 105287770 missense probably benign 0.07
R4912:Ndfip2 UTSW 14 105258685 missense probably benign 0.00
R5102:Ndfip2 UTSW 14 105298105 missense possibly damaging 0.65
R5893:Ndfip2 UTSW 14 105294857 missense probably damaging 1.00
R6152:Ndfip2 UTSW 14 105298104 missense possibly damaging 0.79
R6645:Ndfip2 UTSW 14 105292273 missense probably damaging 1.00
R7071:Ndfip2 UTSW 14 105302326 missense possibly damaging 0.81
R7196:Ndfip2 UTSW 14 105298038 missense probably damaging 1.00
R7699:Ndfip2 UTSW 14 105287759 missense possibly damaging 0.63
R7700:Ndfip2 UTSW 14 105287759 missense possibly damaging 0.63
R7836:Ndfip2 UTSW 14 105292241 missense probably benign 0.01
R7846:Ndfip2 UTSW 14 105298014 missense probably damaging 1.00
Z1176:Ndfip2 UTSW 14 105258709 missense probably benign 0.00
Z1177:Ndfip2 UTSW 14 105258712 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- CACAGAAGTTTGCAATCGCG -3'
(R):5'- TCTTTCCCTATGTTGGTAAGAAGC -3'

Sequencing Primer
(F):5'- GCAATCGCGTAAGAGTTTCTTC -3'
(R):5'- GCAAAGTGGGAGCCAACCTTC -3'
Posted On2016-11-21