Incidental Mutation 'R5759:Trib1'
ID445208
Institutional Source Beutler Lab
Gene Symbol Trib1
Ensembl Gene ENSMUSG00000032501
Gene Nametribbles pseudokinase 1
SynonymsTrb1, A530090O15Rik
MMRRC Submission 043361-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5759 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location59648350-59657099 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 59654501 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 307 (V307I)
Ref Sequence ENSEMBL: ENSMUSP00000068834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067543] [ENSMUST00000118228]
Predicted Effect probably benign
Transcript: ENSMUST00000067543
AA Change: V307I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000068834
Gene: ENSMUSG00000032501
AA Change: V307I

DomainStartEndE-ValueType
low complexity region 61 82 N/A INTRINSIC
Pfam:Pkinase 105 338 1.1e-33 PFAM
Pfam:Pkinase_Tyr 120 335 2.1e-15 PFAM
Pfam:Kinase-like 124 326 1.4e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118228
SMART Domains Protein: ENSMUSP00000112828
Gene: ENSMUSG00000032501

DomainStartEndE-ValueType
low complexity region 61 82 N/A INTRINSIC
Pfam:Pkinase 104 218 7.9e-12 PFAM
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.8%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Macrophages from mice homozygous for a knock-out allele exhibit impaired IL12 response to LPS, MALP-1, or CpG DNA. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,068,658 S1203P probably benign Het
Adamts1 A G 16: 85,798,048 V341A possibly damaging Het
AF529169 A T 9: 89,601,072 N757K probably benign Het
Arf2 G A 11: 103,983,633 G144S probably benign Het
Atr A G 9: 95,874,402 N862D probably benign Het
Cep295nl T C 11: 118,333,646 H124R possibly damaging Het
Chd6 C T 2: 160,983,762 V1141I possibly damaging Het
Chst5 C A 8: 111,890,210 K259N probably benign Het
Dchs1 T A 7: 105,764,176 D1144V probably damaging Het
Dmxl2 T C 9: 54,375,508 Y2795C probably damaging Het
Dnah7b A G 1: 46,277,120 N3131S probably damaging Het
Dnah7c G A 1: 46,615,367 G1436R probably damaging Het
Emp2 T A 16: 10,284,510 Y146F probably damaging Het
Exoc6 C T 19: 37,573,741 Q148* probably null Het
Fam13b T C 18: 34,497,435 D90G probably damaging Het
Fam186b T G 15: 99,279,717 Y576S probably benign Het
Fras1 T C 5: 96,709,916 V2023A probably benign Het
Gm14409 A T 2: 177,264,972 C244* probably null Het
Grm5 A C 7: 88,026,600 M441L probably damaging Het
Hhatl A G 9: 121,788,277 Y297H probably damaging Het
Ifi30 A G 8: 70,766,544 probably benign Het
Ing2 G T 8: 47,669,005 N169K possibly damaging Het
Kat6a T G 8: 22,938,012 S1128A probably benign Het
Madd T C 2: 91,162,075 E1041G possibly damaging Het
Mcm3 CT CTT 1: 20,808,748 probably null Het
Mfsd5 G A 15: 102,281,078 G295D possibly damaging Het
Mmp20 T A 9: 7,628,377 probably null Het
Mybphl T C 3: 108,374,754 V100A probably benign Het
Ndfip2 T A 14: 105,302,316 probably null Het
Olfr862 A G 9: 19,884,188 V39A probably benign Het
Olfr869 T A 9: 20,137,932 V272E probably benign Het
Olfr905 T A 9: 38,473,535 S263T possibly damaging Het
Phf19 T G 2: 34,897,123 D443A probably damaging Het
Piezo1 A G 8: 122,507,655 V84A probably damaging Het
Sept9 A G 11: 117,352,268 I94V probably benign Het
Slc35a1 C A 4: 34,675,032 V132L probably benign Het
Sntg1 G A 1: 8,414,270 S442L probably benign Het
Tcf25 A G 8: 123,381,457 T84A probably benign Het
Tchhl1 C G 3: 93,471,556 S522R probably damaging Het
Tmem106b A G 6: 13,075,042 E76G probably damaging Het
Tnk2 C T 16: 32,680,664 P932S probably benign Het
Trib3 A T 2: 152,343,295 D11E probably benign Het
Trim34b T C 7: 104,331,433 S243P possibly damaging Het
Vmn2r50 A G 7: 10,047,978 I280T probably damaging Het
Zfp445 G T 9: 122,853,146 Q577K probably benign Het
Zfp599 T C 9: 22,249,661 K403E probably damaging Het
Other mutations in Trib1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01140:Trib1 APN 15 59651627 missense probably damaging 1.00
IGL01648:Trib1 APN 15 59654501 missense probably benign 0.38
IGL02267:Trib1 APN 15 59651600 missense probably damaging 0.98
IGL03018:Trib1 APN 15 59654484 missense probably damaging 1.00
topcat UTSW 15 59651638 nonsense probably null
R1994:Trib1 UTSW 15 59649343 missense possibly damaging 0.70
R2073:Trib1 UTSW 15 59654340 missense probably damaging 1.00
R2407:Trib1 UTSW 15 59654600 missense probably benign 0.00
R3709:Trib1 UTSW 15 59654361 missense probably damaging 1.00
R5986:Trib1 UTSW 15 59654602 unclassified probably null
R6083:Trib1 UTSW 15 59654475 missense probably damaging 1.00
R6084:Trib1 UTSW 15 59654475 missense probably damaging 1.00
R6086:Trib1 UTSW 15 59654475 missense probably damaging 1.00
R6112:Trib1 UTSW 15 59651638 nonsense probably null
R6113:Trib1 UTSW 15 59651638 nonsense probably null
R6316:Trib1 UTSW 15 59649415 missense probably benign
R7288:Trib1 UTSW 15 59654622 missense probably benign
R7663:Trib1 UTSW 15 59651713 missense probably damaging 1.00
R7744:Trib1 UTSW 15 59654663 missense probably benign 0.04
R8061:Trib1 UTSW 15 59651555 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGATGCGCTGTCAGATAAACATG -3'
(R):5'- GGAACTTATGTCACTGTCCTCC -3'

Sequencing Primer
(F):5'- GCTGTCAGATAAACATGGCTGCC -3'
(R):5'- CTGGTACTCAGGAACAATCTGGTC -3'
Posted On2016-11-21