Incidental Mutation 'R5759:Fam186b'
ID445209
Institutional Source Beutler Lab
Gene Symbol Fam186b
Ensembl Gene ENSMUSG00000078907
Gene Namefamily with sequence similarity 186, member B
SynonymsEG545136
MMRRC Submission 043361-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5759 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location99271018-99295888 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 99279717 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Serine at position 576 (Y576S)
Ref Sequence ENSEMBL: ENSMUSP00000104728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109100] [ENSMUST00000230608]
Predicted Effect probably benign
Transcript: ENSMUST00000109100
AA Change: Y576S

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000104728
Gene: ENSMUSG00000078907
AA Change: Y576S

DomainStartEndE-ValueType
Blast:FBG 12 193 1e-19 BLAST
low complexity region 354 363 N/A INTRINSIC
low complexity region 478 493 N/A INTRINSIC
low complexity region 508 522 N/A INTRINSIC
low complexity region 789 810 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000230608
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.8%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a member of the FAM186 family, however, its exact function is not known. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,068,658 S1203P probably benign Het
Adamts1 A G 16: 85,798,048 V341A possibly damaging Het
AF529169 A T 9: 89,601,072 N757K probably benign Het
Arf2 G A 11: 103,983,633 G144S probably benign Het
Atr A G 9: 95,874,402 N862D probably benign Het
Cep295nl T C 11: 118,333,646 H124R possibly damaging Het
Chd6 C T 2: 160,983,762 V1141I possibly damaging Het
Chst5 C A 8: 111,890,210 K259N probably benign Het
Dchs1 T A 7: 105,764,176 D1144V probably damaging Het
Dmxl2 T C 9: 54,375,508 Y2795C probably damaging Het
Dnah7b A G 1: 46,277,120 N3131S probably damaging Het
Dnah7c G A 1: 46,615,367 G1436R probably damaging Het
Emp2 T A 16: 10,284,510 Y146F probably damaging Het
Exoc6 C T 19: 37,573,741 Q148* probably null Het
Fam13b T C 18: 34,497,435 D90G probably damaging Het
Fras1 T C 5: 96,709,916 V2023A probably benign Het
Gm14409 A T 2: 177,264,972 C244* probably null Het
Grm5 A C 7: 88,026,600 M441L probably damaging Het
Hhatl A G 9: 121,788,277 Y297H probably damaging Het
Ifi30 A G 8: 70,766,544 probably benign Het
Ing2 G T 8: 47,669,005 N169K possibly damaging Het
Kat6a T G 8: 22,938,012 S1128A probably benign Het
Madd T C 2: 91,162,075 E1041G possibly damaging Het
Mcm3 CT CTT 1: 20,808,748 probably null Het
Mfsd5 G A 15: 102,281,078 G295D possibly damaging Het
Mmp20 T A 9: 7,628,377 probably null Het
Mybphl T C 3: 108,374,754 V100A probably benign Het
Ndfip2 T A 14: 105,302,316 probably null Het
Olfr862 A G 9: 19,884,188 V39A probably benign Het
Olfr869 T A 9: 20,137,932 V272E probably benign Het
Olfr905 T A 9: 38,473,535 S263T possibly damaging Het
Phf19 T G 2: 34,897,123 D443A probably damaging Het
Piezo1 A G 8: 122,507,655 V84A probably damaging Het
Sept9 A G 11: 117,352,268 I94V probably benign Het
Slc35a1 C A 4: 34,675,032 V132L probably benign Het
Sntg1 G A 1: 8,414,270 S442L probably benign Het
Tcf25 A G 8: 123,381,457 T84A probably benign Het
Tchhl1 C G 3: 93,471,556 S522R probably damaging Het
Tmem106b A G 6: 13,075,042 E76G probably damaging Het
Tnk2 C T 16: 32,680,664 P932S probably benign Het
Trib1 G A 15: 59,654,501 V307I probably benign Het
Trib3 A T 2: 152,343,295 D11E probably benign Het
Trim34b T C 7: 104,331,433 S243P possibly damaging Het
Vmn2r50 A G 7: 10,047,978 I280T probably damaging Het
Zfp445 G T 9: 122,853,146 Q577K probably benign Het
Zfp599 T C 9: 22,249,661 K403E probably damaging Het
Other mutations in Fam186b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Fam186b APN 15 99280318 missense probably benign 0.00
IGL01729:Fam186b APN 15 99280251 missense probably benign 0.02
IGL01948:Fam186b APN 15 99280446 missense probably benign 0.00
IGL02133:Fam186b APN 15 99273703 missense probably damaging 0.96
IGL03010:Fam186b APN 15 99280627 missense possibly damaging 0.80
IGL03371:Fam186b APN 15 99280377 missense probably benign 0.00
R0457:Fam186b UTSW 15 99271285 missense probably benign 0.02
R0522:Fam186b UTSW 15 99280519 missense probably benign 0.00
R0571:Fam186b UTSW 15 99286953 missense probably benign 0.02
R0620:Fam186b UTSW 15 99280128 missense probably benign 0.34
R1575:Fam186b UTSW 15 99286971 missense probably benign 0.00
R1883:Fam186b UTSW 15 99278798 missense probably damaging 0.96
R2144:Fam186b UTSW 15 99280657 missense probably benign 0.00
R2267:Fam186b UTSW 15 99285643 missense probably damaging 0.99
R2332:Fam186b UTSW 15 99280428 missense probably benign 0.42
R2394:Fam186b UTSW 15 99280177 missense probably benign 0.01
R3624:Fam186b UTSW 15 99280515 missense probably benign 0.01
R4681:Fam186b UTSW 15 99280890 missense probably benign 0.00
R4811:Fam186b UTSW 15 99280237 missense probably benign 0.01
R4906:Fam186b UTSW 15 99271321 missense probably damaging 0.99
R5028:Fam186b UTSW 15 99280801 missense probably damaging 0.99
R5047:Fam186b UTSW 15 99280686 missense probably damaging 1.00
R5295:Fam186b UTSW 15 99283874 missense probably damaging 1.00
R5440:Fam186b UTSW 15 99273853 missense possibly damaging 0.75
R5468:Fam186b UTSW 15 99278870 missense possibly damaging 0.93
R5596:Fam186b UTSW 15 99271289 missense possibly damaging 0.90
R6239:Fam186b UTSW 15 99280434 missense probably benign
R7117:Fam186b UTSW 15 99285590 missense probably damaging 0.98
R7141:Fam186b UTSW 15 99283892 missense probably benign 0.03
R7223:Fam186b UTSW 15 99279837 missense possibly damaging 0.77
R7301:Fam186b UTSW 15 99278748 missense probably benign 0.00
R7441:Fam186b UTSW 15 99280089 missense probably benign 0.00
R7614:Fam186b UTSW 15 99286986 missense probably damaging 1.00
R7825:Fam186b UTSW 15 99283847 missense not run
R7853:Fam186b UTSW 15 99280747 missense probably damaging 1.00
R8340:Fam186b UTSW 15 99279714 missense probably benign 0.02
R8523:Fam186b UTSW 15 99279732 missense probably benign 0.00
R8821:Fam186b UTSW 15 99280852 missense possibly damaging 0.69
R8939:Fam186b UTSW 15 99279342 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTAGACCTTGTCCTTAGGTGTCCC -3'
(R):5'- CTTCAGCGGCAGAAGAAGTG -3'

Sequencing Primer
(F):5'- TTGCTGCAGAGAGACCTGG -3'
(R):5'- AAGAAGTGGGCCCTGCTG -3'
Posted On2016-11-21