Incidental Mutation 'R5759:Fam13b'
ID445214
Institutional Source Beutler Lab
Gene Symbol Fam13b
Ensembl Gene ENSMUSG00000036501
Gene Namefamily with sequence similarity 13, member B
Synonyms2610024E20Rik
MMRRC Submission 043361-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.338) question?
Stock #R5759 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location34442352-34506823 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34497435 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 90 (D90G)
Ref Sequence ENSEMBL: ENSMUSP00000038199 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040506]
Predicted Effect probably damaging
Transcript: ENSMUST00000040506
AA Change: D90G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000038199
Gene: ENSMUSG00000036501
AA Change: D90G

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
RhoGAP 36 209 3.28e-44 SMART
coiled coil region 220 240 N/A INTRINSIC
low complexity region 280 295 N/A INTRINSIC
low complexity region 484 495 N/A INTRINSIC
coiled coil region 507 532 N/A INTRINSIC
low complexity region 719 726 N/A INTRINSIC
coiled coil region 778 807 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.8%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,068,658 S1203P probably benign Het
Adamts1 A G 16: 85,798,048 V341A possibly damaging Het
AF529169 A T 9: 89,601,072 N757K probably benign Het
Arf2 G A 11: 103,983,633 G144S probably benign Het
Atr A G 9: 95,874,402 N862D probably benign Het
Cep295nl T C 11: 118,333,646 H124R possibly damaging Het
Chd6 C T 2: 160,983,762 V1141I possibly damaging Het
Chst5 C A 8: 111,890,210 K259N probably benign Het
Dchs1 T A 7: 105,764,176 D1144V probably damaging Het
Dmxl2 T C 9: 54,375,508 Y2795C probably damaging Het
Dnah7b A G 1: 46,277,120 N3131S probably damaging Het
Dnah7c G A 1: 46,615,367 G1436R probably damaging Het
Emp2 T A 16: 10,284,510 Y146F probably damaging Het
Exoc6 C T 19: 37,573,741 Q148* probably null Het
Fam186b T G 15: 99,279,717 Y576S probably benign Het
Fras1 T C 5: 96,709,916 V2023A probably benign Het
Gm14409 A T 2: 177,264,972 C244* probably null Het
Grm5 A C 7: 88,026,600 M441L probably damaging Het
Hhatl A G 9: 121,788,277 Y297H probably damaging Het
Ifi30 A G 8: 70,766,544 probably benign Het
Ing2 G T 8: 47,669,005 N169K possibly damaging Het
Kat6a T G 8: 22,938,012 S1128A probably benign Het
Madd T C 2: 91,162,075 E1041G possibly damaging Het
Mcm3 CT CTT 1: 20,808,748 probably null Het
Mfsd5 G A 15: 102,281,078 G295D possibly damaging Het
Mmp20 T A 9: 7,628,377 probably null Het
Mybphl T C 3: 108,374,754 V100A probably benign Het
Ndfip2 T A 14: 105,302,316 probably null Het
Olfr862 A G 9: 19,884,188 V39A probably benign Het
Olfr869 T A 9: 20,137,932 V272E probably benign Het
Olfr905 T A 9: 38,473,535 S263T possibly damaging Het
Phf19 T G 2: 34,897,123 D443A probably damaging Het
Piezo1 A G 8: 122,507,655 V84A probably damaging Het
Sept9 A G 11: 117,352,268 I94V probably benign Het
Slc35a1 C A 4: 34,675,032 V132L probably benign Het
Sntg1 G A 1: 8,414,270 S442L probably benign Het
Tcf25 A G 8: 123,381,457 T84A probably benign Het
Tchhl1 C G 3: 93,471,556 S522R probably damaging Het
Tmem106b A G 6: 13,075,042 E76G probably damaging Het
Tnk2 C T 16: 32,680,664 P932S probably benign Het
Trib1 G A 15: 59,654,501 V307I probably benign Het
Trib3 A T 2: 152,343,295 D11E probably benign Het
Trim34b T C 7: 104,331,433 S243P possibly damaging Het
Vmn2r50 A G 7: 10,047,978 I280T probably damaging Het
Zfp445 G T 9: 122,853,146 Q577K probably benign Het
Zfp599 T C 9: 22,249,661 K403E probably damaging Het
Other mutations in Fam13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Fam13b APN 18 34487096 missense possibly damaging 0.92
IGL00402:Fam13b APN 18 34454718 missense probably damaging 1.00
IGL00556:Fam13b APN 18 34497435 missense probably damaging 0.99
IGL02123:Fam13b APN 18 34445618 unclassified probably benign
IGL02313:Fam13b APN 18 34454656 missense probably damaging 1.00
IGL02346:Fam13b APN 18 34462105 missense probably benign 0.00
IGL02347:Fam13b APN 18 34454704 missense probably damaging 1.00
IGL02694:Fam13b APN 18 34451206 critical splice donor site probably null
IGL03347:Fam13b APN 18 34462051 splice site probably benign
R0109:Fam13b UTSW 18 34451308 missense probably benign 0.00
R0233:Fam13b UTSW 18 34448084 missense probably damaging 1.00
R0455:Fam13b UTSW 18 34445528 unclassified probably benign
R1229:Fam13b UTSW 18 34445583 missense probably benign 0.05
R1397:Fam13b UTSW 18 34445583 missense probably benign 0.05
R1571:Fam13b UTSW 18 34497432 missense possibly damaging 0.92
R1703:Fam13b UTSW 18 34451439 critical splice acceptor site probably null
R1732:Fam13b UTSW 18 34487134 missense probably benign 0.04
R1777:Fam13b UTSW 18 34457760 missense possibly damaging 0.84
R1956:Fam13b UTSW 18 34445329 missense possibly damaging 0.69
R2296:Fam13b UTSW 18 34494761 missense possibly damaging 0.88
R3881:Fam13b UTSW 18 34462059 critical splice donor site probably null
R3896:Fam13b UTSW 18 34462955 splice site probably benign
R5277:Fam13b UTSW 18 34462190 missense probably benign
R5817:Fam13b UTSW 18 34457797 missense possibly damaging 0.93
R5897:Fam13b UTSW 18 34454081 missense possibly damaging 0.83
R6009:Fam13b UTSW 18 34497405 missense possibly damaging 0.92
R6020:Fam13b UTSW 18 34494774 missense probably damaging 1.00
R6087:Fam13b UTSW 18 34487139 missense possibly damaging 0.48
R6151:Fam13b UTSW 18 34494277 missense probably damaging 0.96
R6454:Fam13b UTSW 18 34457662 critical splice donor site probably null
R6464:Fam13b UTSW 18 34473631 nonsense probably null
R6679:Fam13b UTSW 18 34487022 missense possibly damaging 0.53
R6723:Fam13b UTSW 18 34498026 missense possibly damaging 0.86
R6990:Fam13b UTSW 18 34497447 missense possibly damaging 0.92
R7420:Fam13b UTSW 18 34494611 missense probably damaging 1.00
R7517:Fam13b UTSW 18 34494607 missense probably damaging 0.98
R7534:Fam13b UTSW 18 34498007 missense probably damaging 0.97
R7889:Fam13b UTSW 18 34457691 missense probably benign 0.00
R8139:Fam13b UTSW 18 34473633 missense possibly damaging 0.50
R8776:Fam13b UTSW 18 34451393 missense probably damaging 1.00
R8776-TAIL:Fam13b UTSW 18 34451393 missense probably damaging 1.00
R8826:Fam13b UTSW 18 34498017 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GATCCAAGAATTTTGCCACTCC -3'
(R):5'- TGCATATGTGGCTAGACACTTG -3'

Sequencing Primer
(F):5'- AAGAATTTTGCCACTCCCTTAAC -3'
(R):5'- GACACTTGAAGGTGCAGCTTAATTC -3'
Posted On2016-11-21