Incidental Mutation 'R5760:En2'
ID 445236
Institutional Source Beutler Lab
Gene Symbol En2
Ensembl Gene ENSMUSG00000039095
Gene Name engrailed 2
Synonyms En-2
MMRRC Submission 043362-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.743) question?
Stock # R5760 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 28165694-28172166 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 28166999 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Aspartic acid at position 158 (A158D)
Ref Sequence ENSEMBL: ENSMUSP00000036761 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036177]
AlphaFold P09066
Predicted Effect probably benign
Transcript: ENSMUST00000036177
AA Change: A158D

PolyPhen 2 Score 0.412 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000036761
Gene: ENSMUSG00000039095
AA Change: A158D

DomainStartEndE-ValueType
low complexity region 21 39 N/A INTRINSIC
low complexity region 81 112 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
HOX 235 297 1.72e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199117
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Homeobox-containing genes are thought to have a role in controlling development. In Drosophila, the 'engrailed' (en) gene plays an important role during development in segmentation, where it is required for the formation of posterior compartments. Different mutations in the mouse homologs, En1 and En2, produced different developmental defects that frequently are lethal. The human engrailed homologs 1 and 2 encode homeodomain-containing proteins and have been implicated in the control of pattern formation during development of the central nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: This locus affects anterior-posterior cerebellar patterning. Homozygous null mutants show altered foliation pattern and perform poorly in motor learning (rotarod) tests. Heterozygotes test intermediate on rotarod. Hypomorphs show no phenotypic effects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447A16Rik T C 15: 37,439,591 probably benign Het
Abl2 C T 1: 156,641,857 T793M probably benign Het
Accs A C 2: 93,845,760 L90R probably damaging Het
Ahnak A T 19: 9,013,562 D4070V probably damaging Het
Apbb2 A G 5: 66,362,757 V475A probably benign Het
Atp10d T A 5: 72,260,937 V602E probably benign Het
Cdh23 C T 10: 60,406,392 V1088M probably damaging Het
Dennd6a A T 14: 26,612,040 I144L probably damaging Het
Dnajc6 G A 4: 101,618,642 A571T probably benign Het
Drap1 A G 19: 5,424,363 I18T probably damaging Het
Fbn1 C T 2: 125,361,247 G1219R probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Gm7535 C T 17: 17,911,818 probably benign Het
Hao2 A T 3: 98,880,432 L227* probably null Het
Hdlbp C T 1: 93,440,777 probably benign Het
Hivep3 A G 4: 120,095,011 K175E possibly damaging Het
Hmcn2 G A 2: 31,414,568 A3075T possibly damaging Het
Igkv6-15 A T 6: 70,406,532 I95N probably damaging Het
Itgad A T 7: 128,203,365 Q1001L probably benign Het
Jaml T A 9: 45,097,754 M151K probably benign Het
Lix1 T A 17: 17,427,237 V55D possibly damaging Het
Macf1 A G 4: 123,513,884 S179P probably damaging Het
Matn2 T A 15: 34,355,607 Q33L possibly damaging Het
Mcm3 CT CTT 1: 20,808,748 probably null Het
Mroh5 A C 15: 73,821,507 I28S probably damaging Het
Naip5 T G 13: 100,242,838 K231N probably damaging Het
Neb A C 2: 52,183,818 Y5683D probably damaging Het
Npc1l1 A T 11: 6,229,031 H126Q probably benign Het
Npm2 A G 14: 70,649,495 F110L probably damaging Het
Nsd3 A T 8: 25,659,756 H319L probably damaging Het
Nup205 G A 6: 35,247,343 R2039Q probably damaging Het
Olfr1406 C A 1: 173,183,751 A228S probably benign Het
Olfr1415 A G 1: 92,491,200 L185P possibly damaging Het
Olfr77 A C 9: 19,920,754 T182P probably benign Het
Pcdhac2 G A 18: 37,146,400 G811E probably damaging Het
Pkhd1 T A 1: 20,073,554 R3849S probably benign Het
Pmfbp1 A T 8: 109,521,023 D317V probably damaging Het
Sall1 T C 8: 89,028,650 N1234D possibly damaging Het
Slc12a7 T A 13: 73,813,622 V1037D probably damaging Het
Slc12a8 G T 16: 33,624,785 E404* probably null Het
Tchhl1 C G 3: 93,471,556 S522R probably damaging Het
Tgif1 A G 17: 70,845,001 V152A probably damaging Het
Tshz3 C A 7: 36,771,569 H994Q probably damaging Het
Ubash3b T G 9: 41,077,423 K62T probably benign Het
Ushbp1 G T 8: 71,387,368 D546E probably damaging Het
Zfp458 A C 13: 67,257,789 C192W probably damaging Het
Zfp808 A T 13: 62,171,926 H323L probably damaging Het
Other mutations in En2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02943:En2 APN 5 28166526 utr 5 prime probably benign
R0928:En2 UTSW 5 28170331 nonsense probably null
R2083:En2 UTSW 5 28167073 missense probably damaging 0.98
R2356:En2 UTSW 5 28166332 start gained probably benign
R2762:En2 UTSW 5 28170421 missense probably damaging 0.99
R5470:En2 UTSW 5 28166924 missense probably benign 0.03
R6762:En2 UTSW 5 28170353 missense possibly damaging 0.65
R7640:En2 UTSW 5 28170166 nonsense probably null
R7687:En2 UTSW 5 28170289 missense probably damaging 1.00
R7827:En2 UTSW 5 28166596 missense probably benign
R8409:En2 UTSW 5 28166884 missense probably benign
R8861:En2 UTSW 5 28166735 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCGATAACATCCTGCGGC -3'
(R):5'- AATAGCGCGTGCAGTAGACC -3'

Sequencing Primer
(F):5'- ATAACATCCTGCGGCCTGAG -3'
(R):5'- TGCAGTAGACCCAAGCGG -3'
Posted On 2016-11-21