Incidental Mutation 'R5760:Nup205'
ID445240
Institutional Source Beutler Lab
Gene Symbol Nup205
Ensembl Gene ENSMUSG00000038759
Gene Namenucleoporin 205
Synonyms3830404O05Rik
MMRRC Submission 043362-MU
Accession Numbers

NCBI RefSeq: NM_027513.1; MGI:2141625

Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock #R5760 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location35177421-35247596 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 35247343 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 2039 (R2039Q)
Ref Sequence ENSEMBL: ENSMUSP00000144126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043815] [ENSMUST00000170234] [ENSMUST00000201374]
Predicted Effect probably damaging
Transcript: ENSMUST00000043815
AA Change: R1986Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000039656
Gene: ENSMUSG00000038759
AA Change: R1986Q

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:Nup192 14 1684 N/A PFAM
low complexity region 1995 2005 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157183
Predicted Effect probably benign
Transcript: ENSMUST00000170234
SMART Domains Protein: ENSMUSP00000130033
Gene: ENSMUSG00000038759

DomainStartEndE-ValueType
Pfam:DUF3414 13 322 9.7e-98 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200739
Predicted Effect probably damaging
Transcript: ENSMUST00000201374
AA Change: R2039Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000144126
Gene: ENSMUSG00000038759
AA Change: R2039Q

DomainStartEndE-ValueType
low complexity region 36 50 N/A INTRINSIC
Pfam:Nup192 67 1737 N/A PFAM
low complexity region 2048 2058 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201609
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleoporin, which is a subunit of the nuclear pore complex that functions in active transport of proteins, RNAs and ribonucleoprotein particles between the nucleus and cytoplasm. Mutations in this gene are associated with steroid-resistant nephrotic syndrome. [provided by RefSeq, Jul 2016]
Allele List at MGI

All alleles(32) : Targeted(2) Gene trapped(30)

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447A16Rik T C 15: 37,439,591 probably benign Het
Abl2 C T 1: 156,641,857 T793M probably benign Het
Accs A C 2: 93,845,760 L90R probably damaging Het
Ahnak A T 19: 9,013,562 D4070V probably damaging Het
Apbb2 A G 5: 66,362,757 V475A probably benign Het
Atp10d T A 5: 72,260,937 V602E probably benign Het
Cdh23 C T 10: 60,406,392 V1088M probably damaging Het
Dennd6a A T 14: 26,612,040 I144L probably damaging Het
Dnajc6 G A 4: 101,618,642 A571T probably benign Het
Drap1 A G 19: 5,424,363 I18T probably damaging Het
En2 C A 5: 28,166,999 A158D probably benign Het
Fbn1 C T 2: 125,361,247 G1219R probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Gm7535 C T 17: 17,911,818 probably benign Het
Hao2 A T 3: 98,880,432 L227* probably null Het
Hdlbp C T 1: 93,440,777 probably benign Het
Hivep3 A G 4: 120,095,011 K175E possibly damaging Het
Hmcn2 G A 2: 31,414,568 A3075T possibly damaging Het
Igkv6-15 A T 6: 70,406,532 I95N probably damaging Het
Itgad A T 7: 128,203,365 Q1001L probably benign Het
Jaml T A 9: 45,097,754 M151K probably benign Het
Lix1 T A 17: 17,427,237 V55D possibly damaging Het
Macf1 A G 4: 123,513,884 S179P probably damaging Het
Matn2 T A 15: 34,355,607 Q33L possibly damaging Het
Mcm3 CT CTT 1: 20,808,748 probably null Het
Mroh5 A C 15: 73,821,507 I28S probably damaging Het
Naip5 T G 13: 100,242,838 K231N probably damaging Het
Neb A C 2: 52,183,818 Y5683D probably damaging Het
Npc1l1 A T 11: 6,229,031 H126Q probably benign Het
Npm2 A G 14: 70,649,495 F110L probably damaging Het
Nsd3 A T 8: 25,659,756 H319L probably damaging Het
Olfr1406 C A 1: 173,183,751 A228S probably benign Het
Olfr1415 A G 1: 92,491,200 L185P possibly damaging Het
Olfr77 A C 9: 19,920,754 T182P probably benign Het
Pcdhac2 G A 18: 37,146,400 G811E probably damaging Het
Pkhd1 T A 1: 20,073,554 R3849S probably benign Het
Pmfbp1 A T 8: 109,521,023 D317V probably damaging Het
Sall1 T C 8: 89,028,650 N1234D possibly damaging Het
Slc12a7 T A 13: 73,813,622 V1037D probably damaging Het
Slc12a8 G T 16: 33,624,785 E404* probably null Het
Tchhl1 C G 3: 93,471,556 S522R probably damaging Het
Tgif1 A G 17: 70,845,001 V152A probably damaging Het
Tshz3 C A 7: 36,771,569 H994Q probably damaging Het
Ubash3b T G 9: 41,077,423 K62T probably benign Het
Ushbp1 G T 8: 71,387,368 D546E probably damaging Het
Zfp458 A C 13: 67,257,789 C192W probably damaging Het
Zfp808 A T 13: 62,171,926 H323L probably damaging Het
Other mutations in Nup205
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Nup205 APN 6 35214802 missense probably damaging 1.00
IGL01086:Nup205 APN 6 35208936 splice site probably benign
IGL01138:Nup205 APN 6 35208084 nonsense probably null
IGL01333:Nup205 APN 6 35241063 missense probably benign
IGL01399:Nup205 APN 6 35219689 missense possibly damaging 0.80
IGL01466:Nup205 APN 6 35199959 missense probably benign 0.08
IGL01913:Nup205 APN 6 35227430 missense probably benign 0.10
IGL02159:Nup205 APN 6 35189178 missense probably damaging 1.00
IGL02442:Nup205 APN 6 35190068 missense probably benign 0.01
IGL02447:Nup205 APN 6 35227576 splice site probably null
IGL02558:Nup205 APN 6 35189924 missense probably damaging 1.00
IGL03306:Nup205 APN 6 35208169 missense probably damaging 0.98
IGL03328:Nup205 APN 6 35232414 missense probably damaging 0.99
Figaro UTSW 6 35196714 splice site probably null
spirit UTSW 6 35232408 missense probably damaging 0.98
Susanna UTSW 6 35208109 missense possibly damaging 0.94
voyager UTSW 6 35189885 missense possibly damaging 0.80
P0012:Nup205 UTSW 6 35196543 missense possibly damaging 0.90
R0102:Nup205 UTSW 6 35225780 splice site probably benign
R0102:Nup205 UTSW 6 35225780 splice site probably benign
R0362:Nup205 UTSW 6 35196714 splice site probably null
R0374:Nup205 UTSW 6 35208837 missense probably damaging 1.00
R0415:Nup205 UTSW 6 35214634 splice site probably benign
R0427:Nup205 UTSW 6 35194463 missense probably benign 0.01
R0543:Nup205 UTSW 6 35198969 missense probably benign
R0611:Nup205 UTSW 6 35225968 missense probably null 1.00
R0761:Nup205 UTSW 6 35196428 splice site probably benign
R0828:Nup205 UTSW 6 35194566 missense probably benign
R0906:Nup205 UTSW 6 35236892 missense probably damaging 1.00
R1023:Nup205 UTSW 6 35234706 missense probably damaging 0.98
R1033:Nup205 UTSW 6 35227442 missense probably benign
R1375:Nup205 UTSW 6 35200071 splice site probably benign
R1447:Nup205 UTSW 6 35215185 missense probably benign 0.00
R1468:Nup205 UTSW 6 35225982 critical splice donor site probably null
R1468:Nup205 UTSW 6 35225982 critical splice donor site probably null
R1625:Nup205 UTSW 6 35191943 missense probably benign 0.31
R1652:Nup205 UTSW 6 35238966 missense probably benign
R1659:Nup205 UTSW 6 35234788 missense probably benign 0.02
R1693:Nup205 UTSW 6 35210971 missense probably benign 0.05
R1769:Nup205 UTSW 6 35205431 missense probably damaging 1.00
R1839:Nup205 UTSW 6 35219714 missense probably benign 0.00
R1959:Nup205 UTSW 6 35233366 missense probably benign 0.16
R2051:Nup205 UTSW 6 35230516 missense probably benign 0.34
R2267:Nup205 UTSW 6 35241349 missense possibly damaging 0.67
R2401:Nup205 UTSW 6 35208134 nonsense probably null
R3697:Nup205 UTSW 6 35188711 missense probably benign 0.15
R3938:Nup205 UTSW 6 35219742 missense probably damaging 1.00
R4074:Nup205 UTSW 6 35192040 critical splice donor site probably null
R4117:Nup205 UTSW 6 35241012 nonsense probably null
R4364:Nup205 UTSW 6 35192027 missense probably benign 0.38
R4366:Nup205 UTSW 6 35192027 missense probably benign 0.38
R4594:Nup205 UTSW 6 35196489 missense probably benign 0.00
R4706:Nup205 UTSW 6 35202008 missense probably damaging 1.00
R4787:Nup205 UTSW 6 35202061 missense probably damaging 1.00
R4849:Nup205 UTSW 6 35230570 missense possibly damaging 0.90
R4850:Nup205 UTSW 6 35230530 missense probably benign 0.16
R4943:Nup205 UTSW 6 35224639 missense probably damaging 1.00
R4966:Nup205 UTSW 6 35243849 missense probably benign 0.00
R5138:Nup205 UTSW 6 35225866 missense probably damaging 1.00
R5251:Nup205 UTSW 6 35196482 intron probably null
R5444:Nup205 UTSW 6 35189189 missense probably damaging 0.98
R5762:Nup205 UTSW 6 35227680 missense probably damaging 1.00
R5762:Nup205 UTSW 6 35230548 missense probably damaging 0.96
R5941:Nup205 UTSW 6 35232408 missense probably damaging 0.98
R5969:Nup205 UTSW 6 35177578 unclassified probably benign
R6003:Nup205 UTSW 6 35212816 missense probably benign
R6178:Nup205 UTSW 6 35243843 missense possibly damaging 0.85
R6315:Nup205 UTSW 6 35236869 missense probably damaging 1.00
R6392:Nup205 UTSW 6 35189885 missense possibly damaging 0.80
R6710:Nup205 UTSW 6 35247373 missense probably benign 0.00
R6954:Nup205 UTSW 6 35208109 missense possibly damaging 0.94
R7022:Nup205 UTSW 6 35243936 missense probably benign 0.45
R7041:Nup205 UTSW 6 35224535 missense possibly damaging 0.49
R7052:Nup205 UTSW 6 35215142 missense possibly damaging 0.81
R7310:Nup205 UTSW 6 35225969 missense possibly damaging 0.78
R7363:Nup205 UTSW 6 35232573 missense probably benign 0.28
R7399:Nup205 UTSW 6 35214676 missense probably damaging 0.99
R7428:Nup205 UTSW 6 35227559 missense probably damaging 1.00
R7553:Nup205 UTSW 6 35201999 missense probably damaging 1.00
R7665:Nup205 UTSW 6 35177620 missense possibly damaging 0.46
R7841:Nup205 UTSW 6 35247437 missense unknown
R7924:Nup205 UTSW 6 35247437 missense unknown
Predicted Primers PCR Primer
(F):5'- AAAGGATAGTGTAGCAGTGTTGT -3'
(R):5'- TGTTCACAAGTGAGGGAGAAAT -3'

Sequencing Primer
(F):5'- CAGTGTTGTGAATCAGAGCAC -3'
(R):5'- GAGAGGTTTACAGAAAAGATGTCC -3'
Posted On2016-11-21