Incidental Mutation 'R5760:Zfp458'
ID445258
Institutional Source Beutler Lab
Gene Symbol Zfp458
Ensembl Gene ENSMUSG00000055480
Gene Namezinc finger protein 458
SynonymsRslcan-7
MMRRC Submission 043362-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R5760 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location67254918-67278466 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 67257789 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tryptophan at position 192 (C192W)
Ref Sequence ENSEMBL: ENSMUSP00000153563 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045969] [ENSMUST00000223990] [ENSMUST00000225772]
Predicted Effect probably damaging
Transcript: ENSMUST00000045969
AA Change: C195W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047222
Gene: ENSMUSG00000055480
AA Change: C195W

DomainStartEndE-ValueType
KRAB 5 65 5.27e-32 SMART
ZnF_C2H2 81 103 2.09e-3 SMART
ZnF_C2H2 109 131 1.03e-2 SMART
ZnF_C2H2 137 159 4.11e-2 SMART
ZnF_C2H2 193 215 2.17e1 SMART
ZnF_C2H2 221 243 2.95e-3 SMART
ZnF_C2H2 249 271 7.9e-4 SMART
ZnF_C2H2 277 299 6.32e-3 SMART
ZnF_C2H2 305 327 3.52e-1 SMART
ZnF_C2H2 333 355 1.38e-3 SMART
ZnF_C2H2 361 383 3.63e-3 SMART
ZnF_C2H2 389 411 1.2e-3 SMART
ZnF_C2H2 417 439 3.52e-1 SMART
ZnF_C2H2 445 467 4.87e-4 SMART
ZnF_C2H2 473 495 7.26e-3 SMART
ZnF_C2H2 501 523 1.18e-2 SMART
ZnF_C2H2 529 551 1.56e-2 SMART
ZnF_C2H2 557 579 2.05e-2 SMART
ZnF_C2H2 585 607 7.78e-3 SMART
ZnF_C2H2 641 663 1.76e-1 SMART
ZnF_C2H2 669 691 5.21e-4 SMART
ZnF_C2H2 697 719 5.14e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000223990
AA Change: C192W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000225772
AA Change: C192W

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the C2H2-type zinc finger gene family. The zinc finger proteins are involved in gene regulation and development, and are quite conserved throughout evolution. Like this gene product, a third of the zinc finger proteins containing C2H2 fingers also contain the KRAB domain, which has been found to be involved in protein-protein interactions. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447A16Rik T C 15: 37,439,591 probably benign Het
Abl2 C T 1: 156,641,857 T793M probably benign Het
Accs A C 2: 93,845,760 L90R probably damaging Het
Ahnak A T 19: 9,013,562 D4070V probably damaging Het
Apbb2 A G 5: 66,362,757 V475A probably benign Het
Atp10d T A 5: 72,260,937 V602E probably benign Het
Cdh23 C T 10: 60,406,392 V1088M probably damaging Het
Dennd6a A T 14: 26,612,040 I144L probably damaging Het
Dnajc6 G A 4: 101,618,642 A571T probably benign Het
Drap1 A G 19: 5,424,363 I18T probably damaging Het
En2 C A 5: 28,166,999 A158D probably benign Het
Fbn1 C T 2: 125,361,247 G1219R probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Gm7535 C T 17: 17,911,818 probably benign Het
Hao2 A T 3: 98,880,432 L227* probably null Het
Hdlbp C T 1: 93,440,777 probably benign Het
Hivep3 A G 4: 120,095,011 K175E possibly damaging Het
Hmcn2 G A 2: 31,414,568 A3075T possibly damaging Het
Igkv6-15 A T 6: 70,406,532 I95N probably damaging Het
Itgad A T 7: 128,203,365 Q1001L probably benign Het
Jaml T A 9: 45,097,754 M151K probably benign Het
Lix1 T A 17: 17,427,237 V55D possibly damaging Het
Macf1 A G 4: 123,513,884 S179P probably damaging Het
Matn2 T A 15: 34,355,607 Q33L possibly damaging Het
Mcm3 CT CTT 1: 20,808,748 probably null Het
Mroh5 A C 15: 73,821,507 I28S probably damaging Het
Naip5 T G 13: 100,242,838 K231N probably damaging Het
Neb A C 2: 52,183,818 Y5683D probably damaging Het
Npc1l1 A T 11: 6,229,031 H126Q probably benign Het
Npm2 A G 14: 70,649,495 F110L probably damaging Het
Nsd3 A T 8: 25,659,756 H319L probably damaging Het
Nup205 G A 6: 35,247,343 R2039Q probably damaging Het
Olfr1406 C A 1: 173,183,751 A228S probably benign Het
Olfr1415 A G 1: 92,491,200 L185P possibly damaging Het
Olfr77 A C 9: 19,920,754 T182P probably benign Het
Pcdhac2 G A 18: 37,146,400 G811E probably damaging Het
Pkhd1 T A 1: 20,073,554 R3849S probably benign Het
Pmfbp1 A T 8: 109,521,023 D317V probably damaging Het
Sall1 T C 8: 89,028,650 N1234D possibly damaging Het
Slc12a7 T A 13: 73,813,622 V1037D probably damaging Het
Slc12a8 G T 16: 33,624,785 E404* probably null Het
Tchhl1 C G 3: 93,471,556 S522R probably damaging Het
Tgif1 A G 17: 70,845,001 V152A probably damaging Het
Tshz3 C A 7: 36,771,569 H994Q probably damaging Het
Ubash3b T G 9: 41,077,423 K62T probably benign Het
Ushbp1 G T 8: 71,387,368 D546E probably damaging Het
Zfp808 A T 13: 62,171,926 H323L probably damaging Het
Other mutations in Zfp458
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01672:Zfp458 APN 13 67257236 missense probably benign 0.01
IGL01989:Zfp458 APN 13 67259627 missense probably damaging 0.98
IGL02168:Zfp458 APN 13 67258034 missense probably damaging 0.98
IGL02620:Zfp458 APN 13 67257994 missense probably damaging 1.00
R0014:Zfp458 UTSW 13 67258090 missense possibly damaging 0.71
R0014:Zfp458 UTSW 13 67258090 missense possibly damaging 0.71
R0025:Zfp458 UTSW 13 67257898 missense probably damaging 0.98
R0066:Zfp458 UTSW 13 67259609 nonsense probably null
R0257:Zfp458 UTSW 13 67259642 nonsense probably null
R1218:Zfp458 UTSW 13 67256209 missense probably damaging 0.99
R1292:Zfp458 UTSW 13 67256690 missense probably damaging 1.00
R1490:Zfp458 UTSW 13 67257509 missense probably damaging 1.00
R1664:Zfp458 UTSW 13 67258080 missense possibly damaging 0.95
R2169:Zfp458 UTSW 13 67257049 missense probably damaging 1.00
R3769:Zfp458 UTSW 13 67257482 missense probably damaging 1.00
R5305:Zfp458 UTSW 13 67256318 missense probably benign 0.31
R5364:Zfp458 UTSW 13 67257948 nonsense probably null
R5426:Zfp458 UTSW 13 67257192 nonsense probably null
R6151:Zfp458 UTSW 13 67257598 missense possibly damaging 0.95
R6186:Zfp458 UTSW 13 67257637 missense probably damaging 1.00
R6298:Zfp458 UTSW 13 67256806 missense probably damaging 1.00
R7368:Zfp458 UTSW 13 67257236 missense probably benign 0.01
R7483:Zfp458 UTSW 13 67256914 missense possibly damaging 0.94
R7711:Zfp458 UTSW 13 67259600 missense possibly damaging 0.95
R7921:Zfp458 UTSW 13 67256116 makesense probably null
R7993:Zfp458 UTSW 13 67257170 missense probably damaging 1.00
R8240:Zfp458 UTSW 13 67258126 missense probably damaging 1.00
R8429:Zfp458 UTSW 13 67258088 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- GCCTTGCCACATATATCACACT -3'
(R):5'- ATGTGGCAAGTCCTTCCGTTTT -3'

Sequencing Primer
(F):5'- TGGAAGGTCTTGCCACAAACTTC -3'
(R):5'- TCTGCACATAAAAGAAATCATACAGG -3'
Posted On2016-11-21