Incidental Mutation 'R5760:Naip5'
ID 445260
Institutional Source Beutler Lab
Gene Symbol Naip5
Ensembl Gene ENSMUSG00000071203
Gene Name NLR family, apoptosis inhibitory protein 5
Synonyms Birc1e, Lgn1, Naip-rs3
MMRRC Submission 043362-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock # R5760 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 100211739-100246323 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 100242838 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 231 (K231N)
Ref Sequence ENSEMBL: ENSMUSP00000058611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049789]
AlphaFold Q9R016
Predicted Effect probably damaging
Transcript: ENSMUST00000049789
AA Change: K231N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000058611
Gene: ENSMUSG00000071203
AA Change: K231N

DomainStartEndE-ValueType
low complexity region 36 51 N/A INTRINSIC
BIR 58 129 1.08e-19 SMART
BIR 157 229 1.06e-36 SMART
BIR 276 347 2.14e-32 SMART
Pfam:NACHT 464 618 1.7e-36 PFAM
low complexity region 851 862 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: This locus controls resistance to Legionella pneumophila, the organism responsible for Legionnaire's disease. Cultured peritoneal macrophages from A/J mice are susceptible, supporting bacterial proliferation; other strains, e.g., C57BL/6 are resistant. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447A16Rik T C 15: 37,439,591 probably benign Het
Abl2 C T 1: 156,641,857 T793M probably benign Het
Accs A C 2: 93,845,760 L90R probably damaging Het
Ahnak A T 19: 9,013,562 D4070V probably damaging Het
Apbb2 A G 5: 66,362,757 V475A probably benign Het
Atp10d T A 5: 72,260,937 V602E probably benign Het
Cdh23 C T 10: 60,406,392 V1088M probably damaging Het
Dennd6a A T 14: 26,612,040 I144L probably damaging Het
Dnajc6 G A 4: 101,618,642 A571T probably benign Het
Drap1 A G 19: 5,424,363 I18T probably damaging Het
En2 C A 5: 28,166,999 A158D probably benign Het
Fbn1 C T 2: 125,361,247 G1219R probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Gm7535 C T 17: 17,911,818 probably benign Het
Hao2 A T 3: 98,880,432 L227* probably null Het
Hdlbp C T 1: 93,440,777 probably benign Het
Hivep3 A G 4: 120,095,011 K175E possibly damaging Het
Hmcn2 G A 2: 31,414,568 A3075T possibly damaging Het
Igkv6-15 A T 6: 70,406,532 I95N probably damaging Het
Itgad A T 7: 128,203,365 Q1001L probably benign Het
Jaml T A 9: 45,097,754 M151K probably benign Het
Lix1 T A 17: 17,427,237 V55D possibly damaging Het
Macf1 A G 4: 123,513,884 S179P probably damaging Het
Matn2 T A 15: 34,355,607 Q33L possibly damaging Het
Mcm3 CT CTT 1: 20,808,748 probably null Het
Mroh5 A C 15: 73,821,507 I28S probably damaging Het
Neb A C 2: 52,183,818 Y5683D probably damaging Het
Npc1l1 A T 11: 6,229,031 H126Q probably benign Het
Npm2 A G 14: 70,649,495 F110L probably damaging Het
Nsd3 A T 8: 25,659,756 H319L probably damaging Het
Nup205 G A 6: 35,247,343 R2039Q probably damaging Het
Olfr1406 C A 1: 173,183,751 A228S probably benign Het
Olfr1415 A G 1: 92,491,200 L185P possibly damaging Het
Olfr77 A C 9: 19,920,754 T182P probably benign Het
Pcdhac2 G A 18: 37,146,400 G811E probably damaging Het
Pkhd1 T A 1: 20,073,554 R3849S probably benign Het
Pmfbp1 A T 8: 109,521,023 D317V probably damaging Het
Sall1 T C 8: 89,028,650 N1234D possibly damaging Het
Slc12a7 T A 13: 73,813,622 V1037D probably damaging Het
Slc12a8 G T 16: 33,624,785 E404* probably null Het
Tchhl1 C G 3: 93,471,556 S522R probably damaging Het
Tgif1 A G 17: 70,845,001 V152A probably damaging Het
Tshz3 C A 7: 36,771,569 H994Q probably damaging Het
Ubash3b T G 9: 41,077,423 K62T probably benign Het
Ushbp1 G T 8: 71,387,368 D546E probably damaging Het
Zfp458 A C 13: 67,257,789 C192W probably damaging Het
Zfp808 A T 13: 62,171,926 H323L probably damaging Het
Other mutations in Naip5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Naip5 APN 13 100246175 nonsense probably null
IGL00493:Naip5 APN 13 100230771 missense probably damaging 0.96
IGL01294:Naip5 APN 13 100217080 missense probably damaging 0.99
IGL01405:Naip5 APN 13 100221945 missense probably benign 0.11
IGL01568:Naip5 APN 13 100217101 missense probably benign 0.26
IGL01804:Naip5 APN 13 100221584 missense probably damaging 1.00
IGL02012:Naip5 APN 13 100223339 missense probably benign 0.01
IGL02183:Naip5 APN 13 100221642 missense probably benign 0.41
IGL02449:Naip5 APN 13 100222175 missense probably benign 0.34
IGL02815:Naip5 APN 13 100222731 missense probably benign
IGL02992:Naip5 APN 13 100223028 missense probably damaging 1.00
IGL03027:Naip5 APN 13 100223016 missense probably benign 0.00
IGL03234:Naip5 APN 13 100212627 missense probably damaging 1.00
inwood2 UTSW 13 100223014 nonsense probably null
inwood3 UTSW 13 100221903 nonsense probably null
Nuchal UTSW 13 100214663 missense possibly damaging 0.82
PIT4131001:Naip5 UTSW 13 100219739 missense probably benign
PIT4131001:Naip5 UTSW 13 100219760 missense probably benign 0.00
R0001:Naip5 UTSW 13 100214650 critical splice donor site probably null
R0001:Naip5 UTSW 13 100223114 missense probably benign
R0462:Naip5 UTSW 13 100221732 missense probably damaging 1.00
R0636:Naip5 UTSW 13 100219688 missense probably benign
R0674:Naip5 UTSW 13 100223199 missense probably benign 0.04
R0764:Naip5 UTSW 13 100217105 missense probably benign 0.03
R0837:Naip5 UTSW 13 100230743 missense probably benign
R1179:Naip5 UTSW 13 100219830 missense probably benign
R1302:Naip5 UTSW 13 100221591 missense possibly damaging 0.91
R1441:Naip5 UTSW 13 100219717 missense possibly damaging 0.95
R1513:Naip5 UTSW 13 100222206 missense probably benign
R1638:Naip5 UTSW 13 100212669 missense probably damaging 1.00
R1651:Naip5 UTSW 13 100221911 missense probably benign 0.41
R1707:Naip5 UTSW 13 100242855 missense probably damaging 1.00
R1835:Naip5 UTSW 13 100223218 nonsense probably null
R1836:Naip5 UTSW 13 100219687 missense probably benign 0.18
R1972:Naip5 UTSW 13 100212770 missense probably damaging 0.98
R2080:Naip5 UTSW 13 100221533 missense probably damaging 1.00
R2333:Naip5 UTSW 13 100223171 missense probably damaging 1.00
R2348:Naip5 UTSW 13 100219738 missense probably benign 0.01
R3055:Naip5 UTSW 13 100221878 missense probably benign 0.23
R3401:Naip5 UTSW 13 100221903 nonsense probably null
R3723:Naip5 UTSW 13 100223014 nonsense probably null
R3775:Naip5 UTSW 13 100223375 missense probably benign 0.00
R3775:Naip5 UTSW 13 100223394 missense probably benign 0.00
R4019:Naip5 UTSW 13 100223375 missense probably benign 0.00
R4019:Naip5 UTSW 13 100223394 missense probably benign 0.00
R4020:Naip5 UTSW 13 100223375 missense probably benign 0.00
R4020:Naip5 UTSW 13 100223394 missense probably benign 0.00
R4074:Naip5 UTSW 13 100246064 missense probably damaging 1.00
R4082:Naip5 UTSW 13 100245830 missense probably damaging 1.00
R4105:Naip5 UTSW 13 100219739 missense probably benign
R4227:Naip5 UTSW 13 100212768 missense probably damaging 0.99
R4639:Naip5 UTSW 13 100219830 missense probably benign
R4640:Naip5 UTSW 13 100219830 missense probably benign
R4641:Naip5 UTSW 13 100219830 missense probably benign
R4644:Naip5 UTSW 13 100219830 missense probably benign
R4645:Naip5 UTSW 13 100219830 missense probably benign
R4700:Naip5 UTSW 13 100223414 missense possibly damaging 0.62
R4727:Naip5 UTSW 13 100221870 missense possibly damaging 0.81
R4729:Naip5 UTSW 13 100222131 missense possibly damaging 0.75
R4816:Naip5 UTSW 13 100219681 missense probably benign 0.32
R4816:Naip5 UTSW 13 100219687 missense probably benign 0.01
R4816:Naip5 UTSW 13 100219696 missense probably benign 0.00
R4869:Naip5 UTSW 13 100245131 missense probably damaging 1.00
R5162:Naip5 UTSW 13 100223406 missense possibly damaging 0.78
R5244:Naip5 UTSW 13 100245662 missense probably benign 0.08
R5411:Naip5 UTSW 13 100245746 missense possibly damaging 0.54
R5632:Naip5 UTSW 13 100230662 splice site probably null
R5916:Naip5 UTSW 13 100222701 missense probably benign 0.02
R6302:Naip5 UTSW 13 100223166 missense possibly damaging 0.76
R6304:Naip5 UTSW 13 100223166 missense possibly damaging 0.76
R6411:Naip5 UTSW 13 100223405 missense probably benign 0.01
R6474:Naip5 UTSW 13 100214663 missense possibly damaging 0.82
R6499:Naip5 UTSW 13 100221594 missense probably benign
R6544:Naip5 UTSW 13 100223144 missense possibly damaging 0.50
R6827:Naip5 UTSW 13 100245929 missense possibly damaging 0.48
R6954:Naip5 UTSW 13 100223414 missense probably damaging 0.99
R7052:Naip5 UTSW 13 100222347 missense probably benign 0.01
R7138:Naip5 UTSW 13 100219830 missense probably benign
R7141:Naip5 UTSW 13 100219830 missense probably benign
R7375:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7375:Naip5 UTSW 13 100219697 missense not run
R7401:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7401:Naip5 UTSW 13 100219697 missense not run
R7447:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7447:Naip5 UTSW 13 100219697 missense not run
R7466:Naip5 UTSW 13 100221986 nonsense probably null
R7491:Naip5 UTSW 13 100217071 missense probably benign 0.18
R7559:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7559:Naip5 UTSW 13 100219697 missense not run
R7562:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7562:Naip5 UTSW 13 100219697 missense not run
R7588:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7588:Naip5 UTSW 13 100219697 missense not run
R7589:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7589:Naip5 UTSW 13 100219697 missense not run
R7590:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7590:Naip5 UTSW 13 100219697 missense not run
R7742:Naip5 UTSW 13 100219830 missense probably benign
R7886:Naip5 UTSW 13 100246181 missense probably benign 0.28
R7996:Naip5 UTSW 13 100221656 missense probably damaging 1.00
R8026:Naip5 UTSW 13 100245898 missense probably damaging 1.00
R8046:Naip5 UTSW 13 100222233 missense probably benign
R8319:Naip5 UTSW 13 100221659 missense probably benign 0.12
R8471:Naip5 UTSW 13 100221645 missense probably damaging 0.99
R8480:Naip5 UTSW 13 100222235 missense probably damaging 1.00
R8496:Naip5 UTSW 13 100212739 missense probably benign 0.00
R8500:Naip5 UTSW 13 100222712 missense probably damaging 0.98
R8712:Naip5 UTSW 13 100223096 missense possibly damaging 0.61
R8780:Naip5 UTSW 13 100219830 missense probably benign
R8781:Naip5 UTSW 13 100219830 missense probably benign
R8788:Naip5 UTSW 13 100219830 missense probably benign
R8817:Naip5 UTSW 13 100212699 missense probably benign 0.01
R8833:Naip5 UTSW 13 100222934 missense probably damaging 0.97
R8835:Naip5 UTSW 13 100219830 missense probably benign
R8958:Naip5 UTSW 13 100217609 nonsense probably null
R9031:Naip5 UTSW 13 100219830 missense probably benign
R9032:Naip5 UTSW 13 100219830 missense probably benign
R9074:Naip5 UTSW 13 100221756 missense possibly damaging 0.92
R9098:Naip5 UTSW 13 100229619 missense possibly damaging 0.67
R9204:Naip5 UTSW 13 100222500 missense probably damaging 1.00
R9223:Naip5 UTSW 13 100227676 missense probably benign 0.05
R9358:Naip5 UTSW 13 100219830 missense probably benign
R9389:Naip5 UTSW 13 100219830 missense probably benign
R9403:Naip5 UTSW 13 100219830 missense probably benign
R9518:Naip5 UTSW 13 100221859 missense probably benign
R9568:Naip5 UTSW 13 100219830 missense probably benign
R9568:Naip5 UTSW 13 100223313 missense probably benign 0.00
R9569:Naip5 UTSW 13 100219830 missense probably benign
R9569:Naip5 UTSW 13 100223313 missense probably benign 0.00
R9570:Naip5 UTSW 13 100223313 missense probably benign 0.00
R9572:Naip5 UTSW 13 100223313 missense probably benign 0.00
R9581:Naip5 UTSW 13 100214686 missense probably benign 0.11
R9627:Naip5 UTSW 13 100219830 missense probably benign
Predicted Primers PCR Primer
(F):5'- CACTCTGTGGGTAAGAGGCA -3'
(R):5'- ATAGGGACATATGTGGGATTGGG -3'

Sequencing Primer
(F):5'- TTGTGCCTGAAGACAGCTAC -3'
(R):5'- ACATATGTGGGATTGGGGTATATG -3'
Genotyping

Genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the mutation.

 

PCR Primers

R57600044_PCR_F: 5’- CACTCTGTGGGTAAGAGGCA-3’

R57600044_PCR_R: 5’- ATAGGGACATATGTGGGATTGGG-3’

 

Sequencing Primers

R57600044_SEQ_F: 5’- TTGTGCCTGAAGACAGCTAC-3’
 

R57600044_SEQ_R: 5’- ACATATGTGGGATTGGGGTATATG-3’
 

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               hold

 

The following sequence of 617 nucleotides is amplified:

 

cactctgtgg gtaagaggca gaaggatgaa ggagaaagga agaaagtcac agaaaccata       

aaaacaaaaa caaaaacatt tgggggttgg agacatggct cagaagctaa gagcactgac      

tgctctccca gaggttctga gttcaattcc cagcaaccac aaggtggctc acaaccatct      
gcaatgggat ctgatgccct cttctgttgt gcctgaagac agctactata tacttatata      

cataaaataa atcttaaaaa taaacaaaca aaatacctca cctcagacat taggcagtaa      

gaagattttg gaaaaagttg gctgttgtaa attaccgtta catgaacaaa tccctcgtag      

ctttgaatat actgggcaat ttcctctgag gatttcttac tttgaagaaa ttcacatctg      

taacaaaaag cacaattgac cattttccca atagtgtaat agacatgtcc tctatcacaa      

tgtatatttt tttaatgtgt taatcatttt tggacatttt tacttttaaa actttttatt      

tgatgtactt ttgttaactt tttatggatt ctttgtgaat attaaatcat ataccccaat      

cccacatatg tccctatccctat

 

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text (Chr. (+) = T>G).

Posted On 2016-11-21