Incidental Mutation 'R5760:Gm7535'
ID445267
Institutional Source Beutler Lab
Gene Symbol Gm7535
Ensembl Gene ENSMUSG00000090957
Gene Namepredicted gene 7535
Synonyms
MMRRC Submission 043362-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.191) question?
Stock #R5760 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location17911039-17911947 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) C to T at 17911818 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000093316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054871] [ENSMUST00000164167]
Predicted Effect probably benign
Transcript: ENSMUST00000054871
SMART Domains Protein: ENSMUSP00000093316
Gene: ENSMUSG00000079700

DomainStartEndE-ValueType
Pfam:7tm_1 43 302 2.2e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164167
SMART Domains Protein: ENSMUSP00000125897
Gene: ENSMUSG00000090957

DomainStartEndE-ValueType
Pfam:CNDH2_C 15 292 6.7e-90 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231820
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447A16Rik T C 15: 37,439,591 probably benign Het
Abl2 C T 1: 156,641,857 T793M probably benign Het
Accs A C 2: 93,845,760 L90R probably damaging Het
Ahnak A T 19: 9,013,562 D4070V probably damaging Het
Apbb2 A G 5: 66,362,757 V475A probably benign Het
Atp10d T A 5: 72,260,937 V602E probably benign Het
Cdh23 C T 10: 60,406,392 V1088M probably damaging Het
Dennd6a A T 14: 26,612,040 I144L probably damaging Het
Dnajc6 G A 4: 101,618,642 A571T probably benign Het
Drap1 A G 19: 5,424,363 I18T probably damaging Het
En2 C A 5: 28,166,999 A158D probably benign Het
Fbn1 C T 2: 125,361,247 G1219R probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Hao2 A T 3: 98,880,432 L227* probably null Het
Hdlbp C T 1: 93,440,777 probably benign Het
Hivep3 A G 4: 120,095,011 K175E possibly damaging Het
Hmcn2 G A 2: 31,414,568 A3075T possibly damaging Het
Igkv6-15 A T 6: 70,406,532 I95N probably damaging Het
Itgad A T 7: 128,203,365 Q1001L probably benign Het
Jaml T A 9: 45,097,754 M151K probably benign Het
Lix1 T A 17: 17,427,237 V55D possibly damaging Het
Macf1 A G 4: 123,513,884 S179P probably damaging Het
Matn2 T A 15: 34,355,607 Q33L possibly damaging Het
Mcm3 CT CTT 1: 20,808,748 probably null Het
Mroh5 A C 15: 73,821,507 I28S probably damaging Het
Naip5 T G 13: 100,242,838 K231N probably damaging Het
Neb A C 2: 52,183,818 Y5683D probably damaging Het
Npc1l1 A T 11: 6,229,031 H126Q probably benign Het
Npm2 A G 14: 70,649,495 F110L probably damaging Het
Nsd3 A T 8: 25,659,756 H319L probably damaging Het
Nup205 G A 6: 35,247,343 R2039Q probably damaging Het
Olfr1406 C A 1: 173,183,751 A228S probably benign Het
Olfr1415 A G 1: 92,491,200 L185P possibly damaging Het
Olfr77 A C 9: 19,920,754 T182P probably benign Het
Pcdhac2 G A 18: 37,146,400 G811E probably damaging Het
Pkhd1 T A 1: 20,073,554 R3849S probably benign Het
Pmfbp1 A T 8: 109,521,023 D317V probably damaging Het
Sall1 T C 8: 89,028,650 N1234D possibly damaging Het
Slc12a7 T A 13: 73,813,622 V1037D probably damaging Het
Slc12a8 G T 16: 33,624,785 E404* probably null Het
Tchhl1 C G 3: 93,471,556 S522R probably damaging Het
Tgif1 A G 17: 70,845,001 V152A probably damaging Het
Tshz3 C A 7: 36,771,569 H994Q probably damaging Het
Ubash3b T G 9: 41,077,423 K62T probably benign Het
Ushbp1 G T 8: 71,387,368 D546E probably damaging Het
Zfp458 A C 13: 67,257,789 C192W probably damaging Het
Zfp808 A T 13: 62,171,926 H323L probably damaging Het
Other mutations in Gm7535
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Gm7535 APN 17 17911888 intron probably benign
IGL01663:Gm7535 APN 17 17911357 intron probably benign
R0165:Gm7535 UTSW 17 17911175 intron probably benign
R0335:Gm7535 UTSW 17 17911112 intron probably benign
R1985:Gm7535 UTSW 17 17911538 intron probably benign
R2217:Gm7535 UTSW 17 17911674 intron probably benign
R2218:Gm7535 UTSW 17 17911674 intron probably benign
R4464:Gm7535 UTSW 17 17911662 intron probably benign
R4581:Gm7535 UTSW 17 17911083 intron probably benign
R4887:Gm7535 UTSW 17 17911071 intron probably benign
R5225:Gm7535 UTSW 17 17911547 intron probably benign
R5305:Gm7535 UTSW 17 17911799 intron probably benign
R5641:Gm7535 UTSW 17 17911526 intron probably benign
R5658:Gm7535 UTSW 17 17911320 intron probably benign
Predicted Primers PCR Primer
(F):5'- TCTCCGCAGTTTCTGAAGG -3'
(R):5'- CCCTGAAGGTTGCTCTAGAG -3'

Sequencing Primer
(F):5'- CCGCAGTTTCTGAAGGGTCTC -3'
(R):5'- TCTAGAGCCTGCAGAGCC -3'
Posted On2016-11-21