Incidental Mutation 'R5761:Col4a3'
ID445272
Institutional Source Beutler Lab
Gene Symbol Col4a3
Ensembl Gene ENSMUSG00000079465
Gene Namecollagen, type IV, alpha 3
Synonymsalpha3(IV), tumstatin
MMRRC Submission 043363-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5761 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location82586921-82722059 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 82716057 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 66 (L66*)
Ref Sequence ENSEMBL: ENSMUSP00000119094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113457] [ENSMUST00000125563] [ENSMUST00000152664]
Predicted Effect probably null
Transcript: ENSMUST00000113457
AA Change: L1502*
SMART Domains Protein: ENSMUSP00000109084
Gene: ENSMUSG00000079465
AA Change: L1502*

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Collagen 41 102 9.6e-11 PFAM
Pfam:Collagen 97 164 3.6e-11 PFAM
Pfam:Collagen 164 223 3.6e-9 PFAM
low complexity region 233 243 N/A INTRINSIC
Pfam:Collagen 284 344 2.4e-10 PFAM
low complexity region 368 393 N/A INTRINSIC
Pfam:Collagen 415 477 5e-10 PFAM
Pfam:Collagen 481 545 1e-9 PFAM
low complexity region 550 585 N/A INTRINSIC
Pfam:Collagen 588 653 8.9e-9 PFAM
Pfam:Collagen 682 744 1.1e-8 PFAM
Pfam:Collagen 743 807 6.9e-10 PFAM
Pfam:Collagen 786 847 1.5e-8 PFAM
Pfam:Collagen 845 904 1.5e-10 PFAM
Pfam:Collagen 887 946 4.1e-10 PFAM
Pfam:Collagen 948 1006 8.1e-11 PFAM
Pfam:Collagen 997 1061 2.8e-10 PFAM
Pfam:Collagen 1057 1120 2.5e-10 PFAM
Pfam:Collagen 1114 1176 1.7e-9 PFAM
Pfam:Collagen 1174 1233 1.1e-9 PFAM
Pfam:Collagen 1232 1295 6.9e-9 PFAM
low complexity region 1326 1347 N/A INTRINSIC
Pfam:Collagen 1377 1439 4.9e-11 PFAM
C4 1444 1553 3.77e-70 SMART
C4 1554 1667 3.28e-70 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125563
SMART Domains Protein: ENSMUSP00000137944
Gene: ENSMUSG00000079465

DomainStartEndE-ValueType
Pfam:C4 8 60 4.7e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000152664
AA Change: L66*
SMART Domains Protein: ENSMUSP00000119094
Gene: ENSMUSG00000079465
AA Change: L66*

DomainStartEndE-ValueType
C4 8 117 3.77e-70 SMART
Pfam:C4 118 169 4.1e-14 PFAM
low complexity region 185 196 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181720
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186858
Meta Mutation Damage Score 0.9718 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Type IV collagen, the major structural component of basement membranes, is a multimeric protein composed of 3 alpha subunits. These subunits are encoded by 6 different genes, alpha 1 through alpha 6, each of which can form a triple helix structure with 2 other subunits to form type IV collagen. This gene encodes alpha 3. In the Goodpasture syndrome, autoantibodies bind to the collagen molecules in the basement membranes of alveoli and glomeruli. The epitopes that elicit these autoantibodies are localized largely to the non-collagenous C-terminal domain of the protein. A specific kinase phosphorylates amino acids in this same C-terminal region and the expression of this kinase is upregulated during pathogenesis. This gene is also linked to an autosomal recessive form of Alport syndrome. The mutations contributing to this syndrome are also located within the exons that encode this C-terminal region. Like the other members of the type IV collagen gene family, this gene is organized in a head-to-head conformation with another type IV collagen gene so that each gene pair shares a common promoter. [provided by RefSeq, Jun 2010]
PHENOTYPE: Homozygotes for targeted null mutations exhibit renal pathology including reduced glomerular filtration, impaired glomerular integrity, and glomerulonephrosis, resulting in uremia, proteinuria, and high mortality in young adults. Auditory thresholds aremildly increased across all test frequencies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,210,101 V953D probably damaging Het
Abcb8 T C 5: 24,405,881 probably benign Het
Acad12 A T 5: 121,604,180 probably benign Het
Adam2 A T 14: 66,046,146 C436S probably damaging Het
Aebp2 T C 6: 140,624,217 probably benign Het
AI314180 T C 4: 58,853,131 I401M probably damaging Het
Akap8 A T 17: 32,317,185 C85S possibly damaging Het
Aldh1a3 C A 7: 66,419,179 R19L probably damaging Het
Baz2a A G 10: 128,119,690 T848A possibly damaging Het
Bud13 C T 9: 46,288,052 A237V probably benign Het
Cbarp CGCCTCTGCTGCCTCT CGCCTCT 10: 80,132,233 probably benign Het
Ccdc187 G A 2: 26,276,092 P775L possibly damaging Het
Ccz1 C T 5: 143,992,510 G367R probably damaging Het
Cep104 T C 4: 153,981,224 V56A possibly damaging Het
Chd6 C A 2: 160,957,078 R2362S probably damaging Het
Chd6 C T 2: 160,957,079 R2362K probably damaging Het
Cmc1 T C 9: 118,115,375 E25G probably benign Het
Cntnap5b T C 1: 100,446,894 S1123P probably damaging Het
Crmp1 A G 5: 37,282,868 T329A probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
Cyp3a16 A G 5: 145,442,033 S393P possibly damaging Het
Cyp4f18 T A 8: 71,996,131 I225F probably damaging Het
Ddhd2 A G 8: 25,741,699 V432A probably benign Het
Foxq1 G A 13: 31,559,331 A139T probably damaging Het
Gm10428 G T 11: 62,753,343 probably benign Het
Gpr89 A G 3: 96,892,880 L134P probably damaging Het
Hfe2 T C 3: 96,528,622 S399P probably benign Het
Hrc A T 7: 45,336,601 probably null Het
Igf1r T A 7: 68,207,253 Y988N probably damaging Het
Igf2r A C 17: 12,698,352 probably null Het
Itga2b A G 11: 102,466,274 F260S probably benign Het
Kif2a T A 13: 106,962,164 N698I probably benign Het
Lap3 A C 5: 45,504,805 I316L probably benign Het
Map2k6 T G 11: 110,399,371 probably benign Het
Myh1 A G 11: 67,219,252 E1422G probably damaging Het
Ncoa6 A G 2: 155,408,141 V1081A probably benign Het
Nom1 A G 5: 29,437,641 E380G probably damaging Het
Nwd2 A T 5: 63,725,230 Y75F probably damaging Het
Olfr401 T A 11: 74,121,509 D73E probably damaging Het
Olfr645 G A 7: 104,084,169 R304W probably benign Het
Pkd1l1 A G 11: 8,916,301 V518A probably damaging Het
Ptgs2 A G 1: 150,105,528 M521V probably benign Het
Qsox1 T A 1: 155,779,528 M630L probably benign Het
Skiv2l2 T A 13: 112,917,662 I146F probably damaging Het
Spty2d1 A G 7: 46,998,284 L299P probably damaging Het
St6gal1 T G 16: 23,321,055 probably benign Het
Sult2a6 T C 7: 14,250,358 Y149C probably damaging Het
Tlr3 G A 8: 45,402,771 T124M probably benign Het
Tmem171 A G 13: 98,692,511 Y44H probably damaging Het
Usp35 C T 7: 97,312,351 V623I probably benign Het
Vangl2 T A 1: 172,006,127 H463L probably damaging Het
Vmn1r175 A C 7: 23,808,480 L241V probably benign Het
Vmn1r19 A T 6: 57,405,353 K297I unknown Het
Vmn2r23 C A 6: 123,712,759 T198K probably benign Het
Vmn2r-ps69 T A 7: 85,304,015 noncoding transcript Het
Xirp2 A G 2: 67,510,967 Y1184C probably benign Het
Ythdc1 A G 5: 86,835,951 probably benign Het
Zbtb39 C T 10: 127,742,646 A363V probably damaging Het
Zmiz1 T A 14: 25,651,304 I527K possibly damaging Het
Zmiz1 C A 14: 25,651,306 P534T probably damaging Het
Other mutations in Col4a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00693:Col4a3 APN 1 82697754 missense unknown
IGL00847:Col4a3 APN 1 82717869 missense probably damaging 1.00
IGL01011:Col4a3 APN 1 82682301 missense unknown
IGL01102:Col4a3 APN 1 82669720 missense unknown
IGL01102:Col4a3 APN 1 82670255 missense unknown
IGL02071:Col4a3 APN 1 82660887 critical splice donor site probably null
IGL02244:Col4a3 APN 1 82669771 splice site probably benign
IGL02380:Col4a3 APN 1 82672788 splice site probably benign
IGL02431:Col4a3 APN 1 82679623 nonsense probably null
IGL02466:Col4a3 APN 1 82670192 missense unknown
IGL02694:Col4a3 APN 1 82710794 unclassified probably benign
IGL02709:Col4a3 APN 1 82679112 missense unknown
IGL02752:Col4a3 APN 1 82660225 missense unknown
IGL02792:Col4a3 APN 1 82718803 missense probably damaging 1.00
IGL03203:Col4a3 APN 1 82672639 nonsense probably null
IGL03218:Col4a3 APN 1 82643206 splice site probably benign
FR4976:Col4a3 UTSW 1 82718906 frame shift probably null
PIT4260001:Col4a3 UTSW 1 82682761 missense unknown
PIT4515001:Col4a3 UTSW 1 82682303 missense unknown
R0035:Col4a3 UTSW 1 82672753 missense unknown
R0099:Col4a3 UTSW 1 82717993 missense probably benign 0.41
R0433:Col4a3 UTSW 1 82670219 missense unknown
R0573:Col4a3 UTSW 1 82716363 missense possibly damaging 0.83
R0606:Col4a3 UTSW 1 82672586 splice site probably benign
R0715:Col4a3 UTSW 1 82652158 splice site probably benign
R0961:Col4a3 UTSW 1 82708576 splice site probably benign
R1257:Col4a3 UTSW 1 82716365 missense probably damaging 1.00
R1264:Col4a3 UTSW 1 82643301 splice site probably benign
R1373:Col4a3 UTSW 1 82690087 splice site probably benign
R1694:Col4a3 UTSW 1 82690663 splice site probably null
R1895:Col4a3 UTSW 1 82679108 missense unknown
R1925:Col4a3 UTSW 1 82700373 missense unknown
R1925:Col4a3 UTSW 1 82711874 unclassified probably benign
R2033:Col4a3 UTSW 1 82718011 intron probably benign
R2044:Col4a3 UTSW 1 82696319 missense unknown
R2122:Col4a3 UTSW 1 82654957 missense unknown
R2282:Col4a3 UTSW 1 82708638 missense unknown
R2318:Col4a3 UTSW 1 82648569 splice site probably null
R2421:Col4a3 UTSW 1 82670275 splice site probably benign
R2517:Col4a3 UTSW 1 82680710 missense unknown
R2965:Col4a3 UTSW 1 82648600 missense unknown
R3085:Col4a3 UTSW 1 82651258 missense unknown
R3150:Col4a3 UTSW 1 82657137 splice site probably null
R3947:Col4a3 UTSW 1 82715332 missense probably damaging 1.00
R4756:Col4a3 UTSW 1 82716297 critical splice acceptor site probably null
R4910:Col4a3 UTSW 1 82672679 missense unknown
R4928:Col4a3 UTSW 1 82710977 unclassified probably benign
R5044:Col4a3 UTSW 1 82666546 missense unknown
R5557:Col4a3 UTSW 1 82715247 unclassified probably benign
R5970:Col4a3 UTSW 1 82716329 missense possibly damaging 0.76
R6576:Col4a3 UTSW 1 82708574 intron probably null
R6583:Col4a3 UTSW 1 82641476 missense unknown
R6675:Col4a3 UTSW 1 82668925 missense unknown
R7170:Col4a3 UTSW 1 82715909 intron probably null
R7592:Col4a3 UTSW 1 82648617 missense unknown
R7624:Col4a3 UTSW 1 82718884 missense probably benign
X0067:Col4a3 UTSW 1 82716159 missense probably damaging 0.99
Z1177:Col4a3 UTSW 1 82690039 missense unknown
Predicted Primers PCR Primer
(F):5'- GCATACCCATTTGAGACTTTGG -3'
(R):5'- TGACTCTCTTGTAAAACACAGGG -3'

Sequencing Primer
(F):5'- GAGACTTTGGCTTCCATCCTAAAG -3'
(R):5'- CTCTCTTGTAAAACACAGGGATTGAG -3'
Posted On2016-11-21