Incidental Mutation 'R5761:Vangl2'
ID445276
Institutional Source Beutler Lab
Gene Symbol Vangl2
Ensembl Gene ENSMUSG00000026556
Gene NameVANGL planar cell polarity 2
SynonymsC530001F03Rik, Ltap, loop-tail, Lpp1, strabismus, ska, ska17
MMRRC Submission 043363-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5761 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location172000960-172028444 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 172006127 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 463 (H463L)
Ref Sequence ENSEMBL: ENSMUSP00000106895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027837] [ENSMUST00000111263] [ENSMUST00000111264] [ENSMUST00000138714] [ENSMUST00000153662]
Predicted Effect probably damaging
Transcript: ENSMUST00000027837
AA Change: H423L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000027837
Gene: ENSMUSG00000026556
AA Change: H423L

DomainStartEndE-ValueType
Pfam:Strabismus 22 521 3.1e-267 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111263
AA Change: H423L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106894
Gene: ENSMUSG00000026556
AA Change: H423L

DomainStartEndE-ValueType
Pfam:Strabismus 22 521 3.1e-267 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111264
AA Change: H463L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106895
Gene: ENSMUSG00000026556
AA Change: H463L

DomainStartEndE-ValueType
Pfam:Strabismus 19 272 5e-115 PFAM
Pfam:Strabismus 298 560 1.3e-124 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138714
SMART Domains Protein: ENSMUSP00000117736
Gene: ENSMUSG00000026556

DomainStartEndE-ValueType
Pfam:Strabismus 22 102 2e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148363
Predicted Effect probably benign
Transcript: ENSMUST00000153662
SMART Domains Protein: ENSMUSP00000116522
Gene: ENSMUSG00000026556

DomainStartEndE-ValueType
Pfam:Strabismus 22 130 2.4e-38 PFAM
Meta Mutation Damage Score 0.9555 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein involved in the regulation of planar cell polarity, especially in the stereociliary bundles of the cochlea. The encoded protein transmits directional signals to individual cells or groups of cells in epithelial sheets. This protein is also involved in the development of the neural plate. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous animals do not survive past birth. Developmental defects are seen in the nervous, cardiovascular, skeletal, vestibular, and respiratory systems. Kinked or looped tails are noted in heterozygotes with partial penetrance, along with a head wobble and some nervous system deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,210,101 V953D probably damaging Het
Abcb8 T C 5: 24,405,881 probably benign Het
Acad12 A T 5: 121,604,180 probably benign Het
Adam2 A T 14: 66,046,146 C436S probably damaging Het
Aebp2 T C 6: 140,624,217 probably benign Het
AI314180 T C 4: 58,853,131 I401M probably damaging Het
Akap8 A T 17: 32,317,185 C85S possibly damaging Het
Aldh1a3 C A 7: 66,419,179 R19L probably damaging Het
Baz2a A G 10: 128,119,690 T848A possibly damaging Het
Bud13 C T 9: 46,288,052 A237V probably benign Het
Cbarp CGCCTCTGCTGCCTCT CGCCTCT 10: 80,132,233 probably benign Het
Ccdc187 G A 2: 26,276,092 P775L possibly damaging Het
Ccz1 C T 5: 143,992,510 G367R probably damaging Het
Cep104 T C 4: 153,981,224 V56A possibly damaging Het
Chd6 C A 2: 160,957,078 R2362S probably damaging Het
Chd6 C T 2: 160,957,079 R2362K probably damaging Het
Cmc1 T C 9: 118,115,375 E25G probably benign Het
Cntnap5b T C 1: 100,446,894 S1123P probably damaging Het
Col4a3 T A 1: 82,716,057 L66* probably null Het
Crmp1 A G 5: 37,282,868 T329A probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
Cyp3a16 A G 5: 145,442,033 S393P possibly damaging Het
Cyp4f18 T A 8: 71,996,131 I225F probably damaging Het
Ddhd2 A G 8: 25,741,699 V432A probably benign Het
Foxq1 G A 13: 31,559,331 A139T probably damaging Het
Gm10428 G T 11: 62,753,343 probably benign Het
Gpr89 A G 3: 96,892,880 L134P probably damaging Het
Hfe2 T C 3: 96,528,622 S399P probably benign Het
Hrc A T 7: 45,336,601 probably null Het
Igf1r T A 7: 68,207,253 Y988N probably damaging Het
Igf2r A C 17: 12,698,352 probably null Het
Itga2b A G 11: 102,466,274 F260S probably benign Het
Kif2a T A 13: 106,962,164 N698I probably benign Het
Lap3 A C 5: 45,504,805 I316L probably benign Het
Map2k6 T G 11: 110,399,371 probably benign Het
Myh1 A G 11: 67,219,252 E1422G probably damaging Het
Ncoa6 A G 2: 155,408,141 V1081A probably benign Het
Nom1 A G 5: 29,437,641 E380G probably damaging Het
Nwd2 A T 5: 63,725,230 Y75F probably damaging Het
Olfr401 T A 11: 74,121,509 D73E probably damaging Het
Olfr645 G A 7: 104,084,169 R304W probably benign Het
Pkd1l1 A G 11: 8,916,301 V518A probably damaging Het
Ptgs2 A G 1: 150,105,528 M521V probably benign Het
Qsox1 T A 1: 155,779,528 M630L probably benign Het
Skiv2l2 T A 13: 112,917,662 I146F probably damaging Het
Spty2d1 A G 7: 46,998,284 L299P probably damaging Het
St6gal1 T G 16: 23,321,055 probably benign Het
Sult2a6 T C 7: 14,250,358 Y149C probably damaging Het
Tlr3 G A 8: 45,402,771 T124M probably benign Het
Tmem171 A G 13: 98,692,511 Y44H probably damaging Het
Usp35 C T 7: 97,312,351 V623I probably benign Het
Vmn1r175 A C 7: 23,808,480 L241V probably benign Het
Vmn1r19 A T 6: 57,405,353 K297I unknown Het
Vmn2r23 C A 6: 123,712,759 T198K probably benign Het
Vmn2r-ps69 T A 7: 85,304,015 noncoding transcript Het
Xirp2 A G 2: 67,510,967 Y1184C probably benign Het
Ythdc1 A G 5: 86,835,951 probably benign Het
Zbtb39 C T 10: 127,742,646 A363V probably damaging Het
Zmiz1 C A 14: 25,651,306 P534T probably damaging Het
Zmiz1 T A 14: 25,651,304 I527K possibly damaging Het
Other mutations in Vangl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03117:Vangl2 APN 1 172012848 missense probably damaging 1.00
crimp UTSW 1 172006127 missense probably damaging 1.00
Piggy UTSW 1 172009663 missense possibly damaging 0.95
R0594:Vangl2 UTSW 1 172004657 missense probably damaging 1.00
R0718:Vangl2 UTSW 1 172006217 missense probably damaging 1.00
R1162:Vangl2 UTSW 1 172004847 missense probably damaging 1.00
R1173:Vangl2 UTSW 1 172004786 missense probably damaging 1.00
R1174:Vangl2 UTSW 1 172004786 missense probably damaging 1.00
R1175:Vangl2 UTSW 1 172004786 missense probably damaging 1.00
R1857:Vangl2 UTSW 1 172009897 missense probably damaging 0.99
R2290:Vangl2 UTSW 1 172008546 nonsense probably null
R2421:Vangl2 UTSW 1 172007959 missense probably damaging 1.00
R4024:Vangl2 UTSW 1 172008041 missense probably benign 0.00
R4809:Vangl2 UTSW 1 172009663 missense possibly damaging 0.95
R4980:Vangl2 UTSW 1 172009565 missense probably damaging 1.00
R8053:Vangl2 UTSW 1 172004736 missense probably damaging 1.00
R8297:Vangl2 UTSW 1 172009946 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GAGCAAGCAGACGTCCTAC -3'
(R):5'- GGCCTTCACGCACATTAAGC -3'

Sequencing Primer
(F):5'- CCTGAACAGCTACAGTGAACTC -3'
(R):5'- GCACATTAAGCGGCTGCAG -3'
Posted On2016-11-21