Incidental Mutation 'R0027:Rnf135'
ID44528
Institutional Source Beutler Lab
Gene Symbol Rnf135
Ensembl Gene ENSMUSG00000020707
Gene Namering finger protein 135
SynonymsU 2-3-0, 0610037N03Rik, MGC13061, 2410006N06Rik
MMRRC Submission 038322-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0027 (G1) of strain 730
Quality Score225
Status Validated (trace)
Chromosome11
Chromosomal Location80183851-80199757 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 80193942 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 180 (S180R)
Ref Sequence ENSEMBL: ENSMUSP00000017839 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017839]
Predicted Effect probably benign
Transcript: ENSMUST00000017839
AA Change: S180R

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000017839
Gene: ENSMUSG00000020707
AA Change: S180R

DomainStartEndE-ValueType
RING 21 66 2.76e-7 SMART
low complexity region 95 112 N/A INTRINSIC
PRY 242 294 1.12e-2 SMART
Pfam:SPRY 297 414 7.7e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134909
Meta Mutation Damage Score 0.1248 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a RING finger domain, a motif present in a variety of functionally distinct proteins and known to be involved in protein-protein and protein-DNA interactions. This gene is located in a chromosomal region known to be frequently deleted in patients with neurofibromatosis. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts12 A T 15: 11,285,873 I723F probably damaging Het
Anapc1 G T 2: 128,641,511 D1221E possibly damaging Het
Arhgef28 T A 13: 97,945,696 E1201V possibly damaging Het
Capn12 T A 7: 28,881,960 H79Q probably benign Het
Caprin1 A T 2: 103,775,580 probably benign Het
Carmil3 T A 14: 55,494,403 F196Y probably damaging Het
Casp8ap2 A G 4: 32,643,810 H961R probably benign Het
Cdkl3 C T 11: 52,032,349 probably benign Het
Cic T A 7: 25,287,140 S1299T probably damaging Het
Cic C A 7: 25,287,141 S1299Y probably damaging Het
Col13a1 A G 10: 61,850,161 L684P unknown Het
D10Wsu102e G A 10: 83,364,529 probably benign Het
D430041D05Rik A T 2: 104,255,044 F1053L probably benign Het
Dab1 T C 4: 104,704,199 probably benign Het
Dmxl1 A T 18: 49,957,295 probably benign Het
Dst C T 1: 34,189,119 P1606L probably damaging Het
E130309D02Rik G A 5: 143,308,062 T220I probably damaging Het
Eml1 T C 12: 108,536,298 C708R possibly damaging Het
Fam131b T A 6: 42,318,248 M304L probably benign Het
Foxk1 A T 5: 142,450,340 I321F probably damaging Het
Gm10306 C T 4: 94,556,790 probably benign Het
Gm10985 TA TANA 3: 53,845,256 probably null Het
Gse1 T C 8: 120,566,546 probably benign Het
Hcn3 A G 3: 89,159,825 S79P probably damaging Het
Hspa4 T A 11: 53,283,585 M203L probably benign Het
Kctd7 G A 5: 130,152,573 R279H probably damaging Het
Kif11 C T 19: 37,406,983 probably benign Het
Klf13 T C 7: 63,891,761 N206S probably benign Het
Kpna7 A T 5: 144,989,697 Y482N probably damaging Het
Lamc1 T C 1: 153,262,583 Y175C probably damaging Het
Lrpprc G A 17: 84,767,007 R491* probably null Het
Madd T A 2: 91,152,549 I1350F probably damaging Het
Mbtd1 T C 11: 93,924,549 V321A possibly damaging Het
Mon2 G A 10: 123,036,048 S357L possibly damaging Het
Ndst3 A G 3: 123,671,513 V270A probably damaging Het
Nlrp2 T C 7: 5,322,448 T742A probably damaging Het
Olfr214 T C 6: 116,556,949 S175P probably damaging Het
Papola A C 12: 105,833,136 S675R probably benign Het
Pcdh9 T A 14: 93,888,645 I30F probably null Het
Prl6a1 T A 13: 27,318,028 L126Q probably damaging Het
Prr29 A G 11: 106,376,276 E89G possibly damaging Het
Psmd1 T C 1: 86,094,265 probably benign Het
Rad9b A G 5: 122,351,723 probably benign Het
Rest T C 5: 77,282,551 V939A probably benign Het
Sarm1 C A 11: 78,488,091 R376L probably damaging Het
Scap C A 9: 110,379,730 P613Q probably benign Het
Scube3 C T 17: 28,164,357 R374* probably null Het
Setx T G 2: 29,139,221 V167G probably damaging Het
Snrnp40 T A 4: 130,368,273 H151Q probably damaging Het
Sox21 G T 14: 118,235,617 H7N probably benign Het
Stard9 A T 2: 120,703,501 Q3413L probably benign Het
Sycp1 A G 3: 102,895,910 V528A probably benign Het
Tcl1b3 A T 12: 105,191,239 S47C probably damaging Het
Treml4 T C 17: 48,264,934 S122P possibly damaging Het
Trip11 C T 12: 101,885,169 A879T probably benign Het
Ubr4 C A 4: 139,400,393 N567K probably damaging Het
Zan T C 5: 137,406,519 probably benign Het
Zfp804a G A 2: 82,257,200 D458N probably damaging Het
Zic2 T C 14: 122,476,343 M223T possibly damaging Het
Other mutations in Rnf135
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01371:Rnf135 APN 11 80189255 missense probably benign 0.13
IGL02637:Rnf135 APN 11 80198878 missense probably benign 0.28
IGL03179:Rnf135 APN 11 80194011 missense possibly damaging 0.95
R0282:Rnf135 UTSW 11 80193958 missense probably damaging 0.99
R0496:Rnf135 UTSW 11 80183950 missense probably damaging 1.00
R1680:Rnf135 UTSW 11 80196881 missense possibly damaging 0.70
R2173:Rnf135 UTSW 11 80189240 missense probably benign 0.36
R3721:Rnf135 UTSW 11 80196917 missense probably benign 0.05
R3722:Rnf135 UTSW 11 80196917 missense probably benign 0.05
R4089:Rnf135 UTSW 11 80199046 missense probably damaging 1.00
R4793:Rnf135 UTSW 11 80196949 critical splice donor site probably null
R4901:Rnf135 UTSW 11 80198836 missense probably damaging 1.00
R5640:Rnf135 UTSW 11 80193907 missense probably benign 0.12
R5826:Rnf135 UTSW 11 80199086 missense probably damaging 1.00
R6225:Rnf135 UTSW 11 80189227 missense possibly damaging 0.91
R7096:Rnf135 UTSW 11 80189225 missense probably benign 0.19
R7532:Rnf135 UTSW 11 80198906 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ccaactccCCAGAAAGAAATCTGCc -3'
(R):5'- aTACCCAACTTCCTTTATCAGTCCTGCTCC -3'

Sequencing Primer
(F):5'- acaaaaacaaacacaaacaaacaaac -3'
(R):5'- TATCAGTCCTGCTCCAGTAAAC -3'
Posted On2013-06-11