Mutagenetix > Incidental Mutations

Incidental Mutation 'R5761:Chd6'

445282

Institutional Source

Beutler Lab

Gene Symbol

Chd6

Ensembl Gene

ENSMUSG00000057133

Gene Name

chromodomain helicase DNA binding protein 6

Synonyms

6330406J24Rik, 5430439G14Rik

MMRRC Submission

043363-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.765) question?

Stock #

R5761 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

160946978-161109075 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 160957079 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Lysine at position 2362 (R2362K)

Ref Sequence

ENSEMBL: ENSMUSP00000042291 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039782]

Predicted Effect

probably damaging
Transcript: ENSMUST00000039782
AA Change: R2362K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000042291
Gene: ENSMUSG00000057133
AA Change: R2362K

Domain	Start	End	E-Value	Type
low complexity region	86	106	N/A	INTRINSIC
low complexity region	113	143	N/A	INTRINSIC
low complexity region	214	229	N/A	INTRINSIC
CHROMO	289	355	1.35e-4	SMART
CHROMO	372	430	3.48e-7	SMART
DEXDc	456	658	1.73e-39	SMART
HELICc	812	896	3.84e-23	SMART
low complexity region	1080	1094	N/A	INTRINSIC
Blast:DEXDc	1108	1153	4e-23	BLAST
SANT	1445	1504	1.51e0	SMART
low complexity region	1866	1875	N/A	INTRINSIC
low complexity region	2048	2057	N/A	INTRINSIC
low complexity region	2130	2140	N/A	INTRINSIC
low complexity region	2277	2290	N/A	INTRINSIC
low complexity region	2333	2349	N/A	INTRINSIC
low complexity region	2437	2446	N/A	INTRINSIC
low complexity region	2539	2563	N/A	INTRINSIC
low complexity region	2652	2659	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137152

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143081

Meta Mutation Damage Score

0.0888

Coding Region Coverage

1x: 99.5%
3x: 98.8%
10x: 97.3%
20x: 95.2%

Validation Efficiency

99% (67/68)

MGI Phenotype

FUNCTION: This gene encodes a member of the chromodomain/helicase/DNA-binding domain family of chromatin remodeling enzymes. This protein has been found to be specifically involved in transcription initiation and elongation. Homozygous knockout mice exhibit impaired motor coordination. A pseudogene has been identified on chromosome 8. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous null mice display impaired coordination that is not due to muscle weakness or bradykinesia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca6	A	T	11: 110,210,101	V953D	probably damaging	Het
Abcb8	T	C	5: 24,405,881		probably benign	Het
Acad12	A	T	5: 121,604,180		probably benign	Het
Adam2	A	T	14: 66,046,146	C436S	probably damaging	Het
Aebp2	T	C	6: 140,624,217		probably benign	Het
AI314180	T	C	4: 58,853,131	I401M	probably damaging	Het
Akap8	A	T	17: 32,317,185	C85S	possibly damaging	Het
Aldh1a3	C	A	7: 66,419,179	R19L	probably damaging	Het
Baz2a	A	G	10: 128,119,690	T848A	possibly damaging	Het
Bud13	C	T	9: 46,288,052	A237V	probably benign	Het
Cbarp	CGCCTCTGCTGCCTCT	CGCCTCT	10: 80,132,233		probably benign	Het
Ccdc187	G	A	2: 26,276,092	P775L	possibly damaging	Het
Ccz1	C	T	5: 143,992,510	G367R	probably damaging	Het
Cep104	T	C	4: 153,981,224	V56A	possibly damaging	Het
Cmc1	T	C	9: 118,115,375	E25G	probably benign	Het
Cntnap5b	T	C	1: 100,446,894	S1123P	probably damaging	Het
Col4a3	T	A	1: 82,716,057	L66*	probably null	Het
Crmp1	A	G	5: 37,282,868	T329A	probably benign	Het
Cybb	C	G	X: 9,450,750	D246H	probably benign	Het
Cyp3a16	A	G	5: 145,442,033	S393P	possibly damaging	Het
Cyp4f18	T	A	8: 71,996,131	I225F	probably damaging	Het
Ddhd2	A	G	8: 25,741,699	V432A	probably benign	Het
Foxq1	G	A	13: 31,559,331	A139T	probably damaging	Het
Gm10428	G	T	11: 62,753,343		probably benign	Het
Gpr89	A	G	3: 96,892,880	L134P	probably damaging	Het
Hfe2	T	C	3: 96,528,622	S399P	probably benign	Het
Hrc	A	T	7: 45,336,601		probably null	Het
Igf1r	T	A	7: 68,207,253	Y988N	probably damaging	Het
Igf2r	A	C	17: 12,698,352		probably null	Het
Itga2b	A	G	11: 102,466,274	F260S	probably benign	Het
Kif2a	T	A	13: 106,962,164	N698I	probably benign	Het
Lap3	A	C	5: 45,504,805	I316L	probably benign	Het
Map2k6	T	G	11: 110,399,371		probably benign	Het
Myh1	A	G	11: 67,219,252	E1422G	probably damaging	Het
Ncoa6	A	G	2: 155,408,141	V1081A	probably benign	Het
Nom1	A	G	5: 29,437,641	E380G	probably damaging	Het
Nwd2	A	T	5: 63,725,230	Y75F	probably damaging	Het
Olfr401	T	A	11: 74,121,509	D73E	probably damaging	Het
Olfr645	G	A	7: 104,084,169	R304W	probably benign	Het
Pkd1l1	A	G	11: 8,916,301	V518A	probably damaging	Het
Ptgs2	A	G	1: 150,105,528	M521V	probably benign	Het
Qsox1	T	A	1: 155,779,528	M630L	probably benign	Het
Skiv2l2	T	A	13: 112,917,662	I146F	probably damaging	Het
Spty2d1	A	G	7: 46,998,284	L299P	probably damaging	Het
St6gal1	T	G	16: 23,321,055		probably benign	Het
Sult2a6	T	C	7: 14,250,358	Y149C	probably damaging	Het
Tlr3	G	A	8: 45,402,771	T124M	probably benign	Het
Tmem171	A	G	13: 98,692,511	Y44H	probably damaging	Het
Usp35	C	T	7: 97,312,351	V623I	probably benign	Het
Vangl2	T	A	1: 172,006,127	H463L	probably damaging	Het
Vmn1r175	A	C	7: 23,808,480	L241V	probably benign	Het
Vmn1r19	A	T	6: 57,405,353	K297I	unknown	Het
Vmn2r23	C	A	6: 123,712,759	T198K	probably benign	Het
Vmn2r-ps69	T	A	7: 85,304,015		noncoding transcript	Het
Xirp2	A	G	2: 67,510,967	Y1184C	probably benign	Het
Ythdc1	A	G	5: 86,835,951		probably benign	Het
Zbtb39	C	T	10: 127,742,646	A363V	probably damaging	Het
Zmiz1	T	A	14: 25,651,304	I527K	possibly damaging	Het
Zmiz1	C	A	14: 25,651,306	P534T	probably damaging	Het

Other mutations in Chd6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00837:Chd6	APN	2	161042079	missense	probably benign	0.01
IGL00899:Chd6	APN	2	161029298	splice site	probably benign
IGL01104:Chd6	APN	2	160961927	missense	probably damaging	1.00
IGL01295:Chd6	APN	2	160988370	splice site	probably benign
IGL01717:Chd6	APN	2	160965259	missense	possibly damaging	0.96
IGL01795:Chd6	APN	2	160961374	missense	probably benign	0.00
IGL01814:Chd6	APN	2	161059929	missense	probably benign	0.25
IGL02016:Chd6	APN	2	160983678	missense	probably damaging	1.00
IGL02104:Chd6	APN	2	160977512	missense	probably benign
IGL02158:Chd6	APN	2	161026292	missense	possibly damaging	0.73
IGL02313:Chd6	APN	2	160965675	missense	probably damaging	1.00
IGL02472:Chd6	APN	2	160984452	splice site	probably benign
IGL02522:Chd6	APN	2	160965796	missense	probably benign	0.30
IGL02626:Chd6	APN	2	161039350	splice site	probably benign
IGL02727:Chd6	APN	2	160969463	missense	probably damaging	0.96
IGL02738:Chd6	APN	2	160965698	missense	probably benign	0.45
IGL02743:Chd6	APN	2	160960263	missense	probably damaging	1.00
IGL02800:Chd6	APN	2	160984632	missense	probably damaging	1.00
IGL02811:Chd6	APN	2	160990301	missense	probably damaging	1.00
IGL02850:Chd6	APN	2	161019616	nonsense	probably null
IGL02979:Chd6	APN	2	160966170	missense	possibly damaging	0.48
IGL02993:Chd6	APN	2	161052384	splice site	probably benign
IGL03277:Chd6	APN	2	160983061	missense	probably null	1.00
IGL03346:Chd6	APN	2	160960362	missense	probably benign	0.00
IGL03357:Chd6	APN	2	161018016	splice site	probably benign
IGL03134:Chd6	UTSW	2	160965483	missense	possibly damaging	0.88
R0106:Chd6	UTSW	2	160967902	missense	probably damaging	1.00
R0106:Chd6	UTSW	2	160967902	missense	probably damaging	1.00
R0212:Chd6	UTSW	2	161052847	missense	probably damaging	0.99
R0363:Chd6	UTSW	2	161014324	missense	probably damaging	1.00
R0399:Chd6	UTSW	2	161052688	missense	probably damaging	1.00
R0511:Chd6	UTSW	2	160992191	missense	probably damaging	0.99
R0771:Chd6	UTSW	2	161019580	missense	probably damaging	1.00
R1147:Chd6	UTSW	2	160990271	missense	probably damaging	1.00
R1147:Chd6	UTSW	2	160990271	missense	probably damaging	1.00
R1184:Chd6	UTSW	2	161030802	missense	probably damaging	1.00
R1277:Chd6	UTSW	2	160967815	missense	probably damaging	1.00
R1396:Chd6	UTSW	2	160983103	missense	probably damaging	1.00
R1647:Chd6	UTSW	2	161042058	missense	probably damaging	1.00
R1648:Chd6	UTSW	2	161042058	missense	probably damaging	1.00
R1745:Chd6	UTSW	2	160981667	missense	probably damaging	0.96
R1766:Chd6	UTSW	2	160966639	missense	probably damaging	1.00
R1871:Chd6	UTSW	2	160990256	missense	probably damaging	1.00
R1928:Chd6	UTSW	2	160968000	splice site	probably benign
R1973:Chd6	UTSW	2	160966387	missense	probably damaging	0.99
R2200:Chd6	UTSW	2	160983753	missense	probably damaging	1.00
R2340:Chd6	UTSW	2	160965759	frame shift	probably null
R2341:Chd6	UTSW	2	160965759	frame shift	probably null
R2519:Chd6	UTSW	2	161029876	missense	possibly damaging	0.66
R2919:Chd6	UTSW	2	160967880	missense	possibly damaging	0.89
R3025:Chd6	UTSW	2	160966552	small deletion	probably benign
R3426:Chd6	UTSW	2	160990255	missense	probably damaging	1.00
R3427:Chd6	UTSW	2	160990255	missense	probably damaging	1.00
R4042:Chd6	UTSW	2	160988333	missense	probably damaging	1.00
R4273:Chd6	UTSW	2	160961291	missense	probably benign	0.04
R4360:Chd6	UTSW	2	160949856	missense	possibly damaging	0.48
R4399:Chd6	UTSW	2	160965318	missense	probably benign
R4458:Chd6	UTSW	2	161029876	missense	possibly damaging	0.66
R4583:Chd6	UTSW	2	161014194	missense	probably damaging	1.00
R4625:Chd6	UTSW	2	160969492	missense	probably damaging	1.00
R4740:Chd6	UTSW	2	160970183	missense	probably benign
R4765:Chd6	UTSW	2	160966244	nonsense	probably null
R4779:Chd6	UTSW	2	160949557	missense	probably damaging	1.00
R4877:Chd6	UTSW	2	161029299	splice site	probably benign
R5068:Chd6	UTSW	2	160966369	missense	possibly damaging	0.54
R5215:Chd6	UTSW	2	160949953	missense	probably damaging	1.00
R5275:Chd6	UTSW	2	160969363	missense	probably benign
R5405:Chd6	UTSW	2	160965390	missense	probably benign
R5598:Chd6	UTSW	2	161014112	missense	probably damaging	1.00
R5693:Chd6	UTSW	2	160965265	missense	probably benign
R5697:Chd6	UTSW	2	161018051	missense	probably damaging	1.00
R5715:Chd6	UTSW	2	160949878	missense	probably benign	0.00
R5759:Chd6	UTSW	2	160983762	missense	possibly damaging	0.91
R5761:Chd6	UTSW	2	160957078	missense	probably damaging	1.00
R5954:Chd6	UTSW	2	160965827	missense	probably benign	0.00
R6025:Chd6	UTSW	2	160965582	missense	probably benign
R6104:Chd6	UTSW	2	161014132	missense	probably damaging	1.00
R6247:Chd6	UTSW	2	160950048	missense	probably damaging	1.00
R6393:Chd6	UTSW	2	160979487	missense	probably damaging	1.00
R6452:Chd6	UTSW	2	160965498	missense	possibly damaging	0.76
R6468:Chd6	UTSW	2	161013067	missense	probably damaging	1.00
R6784:Chd6	UTSW	2	160966254	missense	probably damaging	1.00
R6803:Chd6	UTSW	2	160960359	missense	possibly damaging	0.64
R6869:Chd6	UTSW	2	160965730	missense	probably benign
R6895:Chd6	UTSW	2	160988340	missense	probably damaging	1.00
R6925:Chd6	UTSW	2	161013127	missense	probably damaging	0.98
R7061:Chd6	UTSW	2	161025965	nonsense	probably null
R7064:Chd6	UTSW	2	160950063	missense	probably damaging	1.00
R7248:Chd6	UTSW	2	160961279	nonsense	probably null
R7287:Chd6	UTSW	2	161008392	missense	probably benign	0.07
R7431:Chd6	UTSW	2	161026328	missense	possibly damaging	0.92
R7486:Chd6	UTSW	2	160950003	missense	probably damaging	1.00
R7509:Chd6	UTSW	2	161013154	missense	probably damaging	1.00
R7748:Chd6	UTSW	2	160966619	missense	probably benign	0.37
R7785:Chd6	UTSW	2	160970175	missense	possibly damaging	0.51
R8002:Chd6	UTSW	2	160990321	missense	not run
Z1088:Chd6	UTSW	2	160966488	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAAGGGGTGAACTTAAGTCTGTTC -3'
(R):5'- AGGAACTCACTTCGTCCTGC -3'

Sequencing Primer
(F):5'- GCTCTTGCAATTTTGATTATTGGAG -3'
(R):5'- ACTTCGTCCTGCCATCATTATTAC -3'

Posted On

2016-11-21