Incidental Mutation 'R5761:Nwd2'
ID445291
Institutional Source Beutler Lab
Gene Symbol Nwd2
Ensembl Gene ENSMUSG00000090061
Gene NameNACHT and WD repeat domain containing 2
Synonyms3110047P20Rik, B830017A01Rik
MMRRC Submission 043363-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R5761 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location63649102-63810546 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 63725230 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 75 (Y75F)
Ref Sequence ENSEMBL: ENSMUSP00000124712 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159584] [ENSMUST00000162166]
Predicted Effect probably damaging
Transcript: ENSMUST00000159584
AA Change: Y75F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124712
Gene: ENSMUSG00000090061
AA Change: Y75F

DomainStartEndE-ValueType
Pfam:DUF4062 42 145 1.5e-8 PFAM
Blast:AAA 408 691 3e-29 BLAST
WD40 939 995 1.06e2 SMART
WD40 998 1037 8.96e-2 SMART
Blast:WD40 1091 1126 9e-19 BLAST
Blast:WD40 1129 1170 1e-17 BLAST
Blast:WD40 1220 1260 3e-16 BLAST
WD40 1263 1302 3.4e-2 SMART
WD40 1347 1385 2.65e1 SMART
WD40 1386 1425 1.58e2 SMART
Blast:WD40 1466 1507 3e-19 BLAST
Blast:WD40 1606 1644 4e-18 BLAST
Blast:KR 1686 1730 2e-16 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160066
Predicted Effect probably benign
Transcript: ENSMUST00000162166
Meta Mutation Damage Score 0.1031 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 99% (67/68)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,210,101 V953D probably damaging Het
Abcb8 T C 5: 24,405,881 probably benign Het
Acad12 A T 5: 121,604,180 probably benign Het
Adam2 A T 14: 66,046,146 C436S probably damaging Het
Aebp2 T C 6: 140,624,217 probably benign Het
AI314180 T C 4: 58,853,131 I401M probably damaging Het
Akap8 A T 17: 32,317,185 C85S possibly damaging Het
Aldh1a3 C A 7: 66,419,179 R19L probably damaging Het
Baz2a A G 10: 128,119,690 T848A possibly damaging Het
Bud13 C T 9: 46,288,052 A237V probably benign Het
Cbarp CGCCTCTGCTGCCTCT CGCCTCT 10: 80,132,233 probably benign Het
Ccdc187 G A 2: 26,276,092 P775L possibly damaging Het
Ccz1 C T 5: 143,992,510 G367R probably damaging Het
Cep104 T C 4: 153,981,224 V56A possibly damaging Het
Chd6 C A 2: 160,957,078 R2362S probably damaging Het
Chd6 C T 2: 160,957,079 R2362K probably damaging Het
Cmc1 T C 9: 118,115,375 E25G probably benign Het
Cntnap5b T C 1: 100,446,894 S1123P probably damaging Het
Col4a3 T A 1: 82,716,057 L66* probably null Het
Crmp1 A G 5: 37,282,868 T329A probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
Cyp3a16 A G 5: 145,442,033 S393P possibly damaging Het
Cyp4f18 T A 8: 71,996,131 I225F probably damaging Het
Ddhd2 A G 8: 25,741,699 V432A probably benign Het
Foxq1 G A 13: 31,559,331 A139T probably damaging Het
Gm10428 G T 11: 62,753,343 probably benign Het
Gpr89 A G 3: 96,892,880 L134P probably damaging Het
Hfe2 T C 3: 96,528,622 S399P probably benign Het
Hrc A T 7: 45,336,601 probably null Het
Igf1r T A 7: 68,207,253 Y988N probably damaging Het
Igf2r A C 17: 12,698,352 probably null Het
Itga2b A G 11: 102,466,274 F260S probably benign Het
Kif2a T A 13: 106,962,164 N698I probably benign Het
Lap3 A C 5: 45,504,805 I316L probably benign Het
Map2k6 T G 11: 110,399,371 probably benign Het
Myh1 A G 11: 67,219,252 E1422G probably damaging Het
Ncoa6 A G 2: 155,408,141 V1081A probably benign Het
Nom1 A G 5: 29,437,641 E380G probably damaging Het
Olfr401 T A 11: 74,121,509 D73E probably damaging Het
Olfr645 G A 7: 104,084,169 R304W probably benign Het
Pkd1l1 A G 11: 8,916,301 V518A probably damaging Het
Ptgs2 A G 1: 150,105,528 M521V probably benign Het
Qsox1 T A 1: 155,779,528 M630L probably benign Het
Skiv2l2 T A 13: 112,917,662 I146F probably damaging Het
Spty2d1 A G 7: 46,998,284 L299P probably damaging Het
St6gal1 T G 16: 23,321,055 probably benign Het
Sult2a6 T C 7: 14,250,358 Y149C probably damaging Het
Tlr3 G A 8: 45,402,771 T124M probably benign Het
Tmem171 A G 13: 98,692,511 Y44H probably damaging Het
Usp35 C T 7: 97,312,351 V623I probably benign Het
Vangl2 T A 1: 172,006,127 H463L probably damaging Het
Vmn1r175 A C 7: 23,808,480 L241V probably benign Het
Vmn1r19 A T 6: 57,405,353 K297I unknown Het
Vmn2r23 C A 6: 123,712,759 T198K probably benign Het
Vmn2r-ps69 T A 7: 85,304,015 noncoding transcript Het
Xirp2 A G 2: 67,510,967 Y1184C probably benign Het
Ythdc1 A G 5: 86,835,951 probably benign Het
Zbtb39 C T 10: 127,742,646 A363V probably damaging Het
Zmiz1 T A 14: 25,651,304 I527K possibly damaging Het
Zmiz1 C A 14: 25,651,306 P534T probably damaging Het
Other mutations in Nwd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Nwd2 APN 5 63805475 missense probably benign
IGL01111:Nwd2 APN 5 63807300 missense probably damaging 1.00
IGL01152:Nwd2 APN 5 63806529 missense possibly damaging 0.74
IGL01307:Nwd2 APN 5 63808283 missense possibly damaging 0.95
IGL01449:Nwd2 APN 5 63805594 missense probably damaging 1.00
IGL01624:Nwd2 APN 5 63806810 missense probably damaging 1.00
IGL01997:Nwd2 APN 5 63804595 missense probably damaging 0.99
IGL02007:Nwd2 APN 5 63804699 missense possibly damaging 0.87
IGL02143:Nwd2 APN 5 63791653 splice site probably null
IGL02184:Nwd2 APN 5 63805677 missense probably damaging 1.00
IGL02379:Nwd2 APN 5 63805301 missense probably damaging 1.00
IGL02489:Nwd2 APN 5 63805227 missense probably damaging 1.00
IGL02580:Nwd2 APN 5 63808169 missense probably damaging 0.99
IGL02682:Nwd2 APN 5 63804677 missense probably benign 0.03
IGL02682:Nwd2 APN 5 63804678 missense probably damaging 1.00
IGL02891:Nwd2 APN 5 63725227 missense possibly damaging 0.91
IGL03135:Nwd2 APN 5 63805995 missense probably damaging 1.00
IGL03149:Nwd2 APN 5 63805995 missense probably damaging 1.00
R0113:Nwd2 UTSW 5 63807898 missense probably damaging 1.00
R0172:Nwd2 UTSW 5 63806369 missense probably benign 0.44
R0196:Nwd2 UTSW 5 63806351 missense probably benign 0.37
R0239:Nwd2 UTSW 5 63800124 missense probably benign 0.01
R0239:Nwd2 UTSW 5 63800124 missense probably benign 0.01
R0309:Nwd2 UTSW 5 63807218 missense probably damaging 1.00
R0311:Nwd2 UTSW 5 63804998 missense probably damaging 0.99
R0335:Nwd2 UTSW 5 63804773 missense probably benign 0.00
R0384:Nwd2 UTSW 5 63805682 missense probably benign 0.11
R0496:Nwd2 UTSW 5 63806343 missense probably damaging 0.99
R0497:Nwd2 UTSW 5 63806343 missense probably damaging 0.99
R0498:Nwd2 UTSW 5 63806343 missense probably damaging 0.99
R0505:Nwd2 UTSW 5 63805111 missense probably damaging 1.00
R0655:Nwd2 UTSW 5 63791585 missense possibly damaging 0.73
R0762:Nwd2 UTSW 5 63800414 missense probably benign 0.33
R0835:Nwd2 UTSW 5 63800130 missense probably damaging 0.99
R0926:Nwd2 UTSW 5 63807891 missense probably damaging 0.99
R0948:Nwd2 UTSW 5 63807312 missense probably damaging 1.00
R1015:Nwd2 UTSW 5 63806811 missense probably damaging 1.00
R1086:Nwd2 UTSW 5 63806574 missense probably damaging 1.00
R1186:Nwd2 UTSW 5 63650024 utr 5 prime probably benign
R1305:Nwd2 UTSW 5 63745197 missense probably damaging 0.97
R1542:Nwd2 UTSW 5 63806975 missense probably damaging 1.00
R1548:Nwd2 UTSW 5 63800182 missense probably benign 0.00
R1553:Nwd2 UTSW 5 63800505 missense probably benign 0.00
R1636:Nwd2 UTSW 5 63807557 missense probably damaging 1.00
R1658:Nwd2 UTSW 5 63807246 missense probably damaging 1.00
R1763:Nwd2 UTSW 5 63808271 missense probably benign
R1800:Nwd2 UTSW 5 63805574 missense probably benign 0.15
R1813:Nwd2 UTSW 5 63805410 missense probably benign 0.00
R1861:Nwd2 UTSW 5 63804854 missense probably damaging 0.96
R1889:Nwd2 UTSW 5 63807666 missense possibly damaging 0.49
R1896:Nwd2 UTSW 5 63805410 missense probably benign 0.00
R1919:Nwd2 UTSW 5 63806180 missense probably damaging 1.00
R1922:Nwd2 UTSW 5 63794242 missense probably benign
R2258:Nwd2 UTSW 5 63805156 missense probably benign 0.00
R2292:Nwd2 UTSW 5 63805574 missense probably benign 0.15
R2504:Nwd2 UTSW 5 63804374 missense probably benign 0.02
R2869:Nwd2 UTSW 5 63800328 missense probably benign 0.00
R2869:Nwd2 UTSW 5 63800328 missense probably benign 0.00
R2958:Nwd2 UTSW 5 63805982 missense probably benign 0.01
R3034:Nwd2 UTSW 5 63800103 missense probably damaging 1.00
R3422:Nwd2 UTSW 5 63725193 missense possibly damaging 0.46
R3423:Nwd2 UTSW 5 63800161 missense probably damaging 1.00
R3439:Nwd2 UTSW 5 63804552 missense probably benign 0.00
R4193:Nwd2 UTSW 5 63807465 missense probably damaging 1.00
R4254:Nwd2 UTSW 5 63806546 missense possibly damaging 0.74
R4384:Nwd2 UTSW 5 63806571 missense probably damaging 1.00
R4707:Nwd2 UTSW 5 63794322 missense probably damaging 1.00
R4713:Nwd2 UTSW 5 63804460 missense probably benign 0.00
R4735:Nwd2 UTSW 5 63808251 missense probably benign 0.34
R4744:Nwd2 UTSW 5 63806967 missense probably damaging 1.00
R4795:Nwd2 UTSW 5 63805433 missense probably benign 0.21
R4835:Nwd2 UTSW 5 63807846 missense probably benign 0.00
R4839:Nwd2 UTSW 5 63805550 missense possibly damaging 0.92
R4896:Nwd2 UTSW 5 63804808 missense probably damaging 1.00
R5017:Nwd2 UTSW 5 63650141 utr 5 prime probably benign
R5170:Nwd2 UTSW 5 63806037 missense probably damaging 0.99
R5312:Nwd2 UTSW 5 63806072 nonsense probably null
R5330:Nwd2 UTSW 5 63806516 missense probably benign 0.02
R5331:Nwd2 UTSW 5 63806516 missense probably benign 0.02
R5419:Nwd2 UTSW 5 63807708 missense probably benign 0.11
R5434:Nwd2 UTSW 5 63807648 missense probably benign 0.00
R5445:Nwd2 UTSW 5 63805338 missense probably damaging 1.00
R5788:Nwd2 UTSW 5 63807771 missense probably benign 0.00
R5907:Nwd2 UTSW 5 63805983 missense probably damaging 0.99
R5959:Nwd2 UTSW 5 63808070 missense probably benign 0.32
R6002:Nwd2 UTSW 5 63804800 missense probably benign
R6027:Nwd2 UTSW 5 63808220 missense possibly damaging 0.65
R6082:Nwd2 UTSW 5 63805031 missense possibly damaging 0.96
R6163:Nwd2 UTSW 5 63805788 missense probably benign 0.00
R6172:Nwd2 UTSW 5 63806906 missense probably damaging 0.98
R6334:Nwd2 UTSW 5 63800253 missense possibly damaging 0.95
R6447:Nwd2 UTSW 5 63807555 missense probably benign 0.41
R6649:Nwd2 UTSW 5 63725184 missense possibly damaging 0.89
R6855:Nwd2 UTSW 5 63804451 missense probably benign 0.00
R7034:Nwd2 UTSW 5 63804915 missense probably damaging 1.00
R7168:Nwd2 UTSW 5 63807494 missense probably benign 0.04
R7326:Nwd2 UTSW 5 63800409 missense probably damaging 1.00
R7561:Nwd2 UTSW 5 63807091 nonsense probably null
R7576:Nwd2 UTSW 5 63807393 missense probably benign 0.00
R7580:Nwd2 UTSW 5 63808281 missense probably benign 0.05
R7723:Nwd2 UTSW 5 63808004 missense possibly damaging 0.69
R7769:Nwd2 UTSW 5 63804504 missense probably damaging 0.99
RF020:Nwd2 UTSW 5 63805723 nonsense probably null
X0023:Nwd2 UTSW 5 63806963 missense probably damaging 0.99
Z1176:Nwd2 UTSW 5 63725197 missense probably damaging 1.00
Z1176:Nwd2 UTSW 5 63806157 missense probably damaging 1.00
Z1177:Nwd2 UTSW 5 63804984 missense possibly damaging 0.60
Z1177:Nwd2 UTSW 5 63807326 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGAGCACCCCATTTTGATTAC -3'
(R):5'- TGACAAATACCAGGCAGAGTCC -3'

Sequencing Primer
(F):5'- TATAGATACAGGAGCGGAAC -3'
(R):5'- GTCCAAGAAACCGAAGCATAAATATG -3'
Posted On2016-11-21